ID: 1021937415

View in Genome Browser
Species Human (GRCh38)
Location 7:25644923-25644945
Sequence GAGTAGGACGAGAGGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021937409_1021937415 25 Left 1021937409 7:25644875-25644897 CCAAAGGAAACAAGGTCTCAGGT No data
Right 1021937415 7:25644923-25644945 GAGTAGGACGAGAGGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021937415 Original CRISPR GAGTAGGACGAGAGGCTCAG TGG Intergenic
No off target data available for this crispr