ID: 1021937415 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:25644923-25644945 |
| Sequence | GAGTAGGACGAGAGGCTCAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1021937409_1021937415 | 25 | Left | 1021937409 | 7:25644875-25644897 | CCAAAGGAAACAAGGTCTCAGGT | No data | ||
| Right | 1021937415 | 7:25644923-25644945 | GAGTAGGACGAGAGGCTCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1021937415 | Original CRISPR | GAGTAGGACGAGAGGCTCAG TGG | Intergenic | ||
| No off target data available for this crispr | |||||