ID: 1021937687

View in Genome Browser
Species Human (GRCh38)
Location 7:25647240-25647262
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021937685_1021937687 -5 Left 1021937685 7:25647222-25647244 CCAGTTTGTGATCGAGTCTGCTC No data
Right 1021937687 7:25647240-25647262 TGCTCAGCATGTCAGAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021937687 Original CRISPR TGCTCAGCATGTCAGAGCCA GGG Intergenic
No off target data available for this crispr