ID: 1021938353

View in Genome Browser
Species Human (GRCh38)
Location 7:25653734-25653756
Sequence ATGCTGCTGTGTAGATGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021938353_1021938356 12 Left 1021938353 7:25653734-25653756 CCCAAGCATCTACACAGCAGCAT No data
Right 1021938356 7:25653769-25653791 TTTTGTCATCAGTGATGAAAAGG No data
1021938353_1021938357 15 Left 1021938353 7:25653734-25653756 CCCAAGCATCTACACAGCAGCAT No data
Right 1021938357 7:25653772-25653794 TGTCATCAGTGATGAAAAGGAGG No data
1021938353_1021938358 23 Left 1021938353 7:25653734-25653756 CCCAAGCATCTACACAGCAGCAT No data
Right 1021938358 7:25653780-25653802 GTGATGAAAAGGAGGACAATTGG No data
1021938353_1021938360 25 Left 1021938353 7:25653734-25653756 CCCAAGCATCTACACAGCAGCAT No data
Right 1021938360 7:25653782-25653804 GATGAAAAGGAGGACAATTGGGG No data
1021938353_1021938359 24 Left 1021938353 7:25653734-25653756 CCCAAGCATCTACACAGCAGCAT No data
Right 1021938359 7:25653781-25653803 TGATGAAAAGGAGGACAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021938353 Original CRISPR ATGCTGCTGTGTAGATGCTT GGG (reversed) Intergenic
No off target data available for this crispr