ID: 1021938357

View in Genome Browser
Species Human (GRCh38)
Location 7:25653772-25653794
Sequence TGTCATCAGTGATGAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021938354_1021938357 14 Left 1021938354 7:25653735-25653757 CCAAGCATCTACACAGCAGCATT No data
Right 1021938357 7:25653772-25653794 TGTCATCAGTGATGAAAAGGAGG No data
1021938353_1021938357 15 Left 1021938353 7:25653734-25653756 CCCAAGCATCTACACAGCAGCAT No data
Right 1021938357 7:25653772-25653794 TGTCATCAGTGATGAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021938357 Original CRISPR TGTCATCAGTGATGAAAAGG AGG Intergenic
No off target data available for this crispr