ID: 1021942159

View in Genome Browser
Species Human (GRCh38)
Location 7:25688521-25688543
Sequence GCTCAGTGGACAGCCTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021942159_1021942165 13 Left 1021942159 7:25688521-25688543 CCAAAACAGGCTGTCCACTGAGC No data
Right 1021942165 7:25688557-25688579 TTCTACAGTGGTTAAGTACCAGG No data
1021942159_1021942163 1 Left 1021942159 7:25688521-25688543 CCAAAACAGGCTGTCCACTGAGC No data
Right 1021942163 7:25688545-25688567 GGCCTTTTAATTTTCTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021942159 Original CRISPR GCTCAGTGGACAGCCTGTTT TGG (reversed) Intergenic
No off target data available for this crispr