ID: 1021946788

View in Genome Browser
Species Human (GRCh38)
Location 7:25735583-25735605
Sequence TCTGGGCTGTTCAGCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021946788_1021946794 26 Left 1021946788 7:25735583-25735605 CCTTCACTGCTGAACAGCCCAGA No data
Right 1021946794 7:25735632-25735654 TACTTGAGATGAGTTGAAAATGG No data
1021946788_1021946791 3 Left 1021946788 7:25735583-25735605 CCTTCACTGCTGAACAGCCCAGA No data
Right 1021946791 7:25735609-25735631 ACAAGATGAGCAGCTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021946788 Original CRISPR TCTGGGCTGTTCAGCAGTGA AGG (reversed) Intergenic
No off target data available for this crispr