ID: 1021950252

View in Genome Browser
Species Human (GRCh38)
Location 7:25767337-25767359
Sequence CTGGAGCCACAAAACCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021950248_1021950252 -4 Left 1021950248 7:25767318-25767340 CCCATTGCAGCAGTGGGAGCTGG No data
Right 1021950252 7:25767337-25767359 CTGGAGCCACAAAACCAGAAGGG No data
1021950250_1021950252 -5 Left 1021950250 7:25767319-25767341 CCATTGCAGCAGTGGGAGCTGGA No data
Right 1021950252 7:25767337-25767359 CTGGAGCCACAAAACCAGAAGGG No data
1021950244_1021950252 24 Left 1021950244 7:25767290-25767312 CCAAAGAGACATTTCTATTATCC No data
Right 1021950252 7:25767337-25767359 CTGGAGCCACAAAACCAGAAGGG No data
1021950245_1021950252 3 Left 1021950245 7:25767311-25767333 CCAAAAGCCCATTGCAGCAGTGG No data
Right 1021950252 7:25767337-25767359 CTGGAGCCACAAAACCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021950252 Original CRISPR CTGGAGCCACAAAACCAGAA GGG Intergenic
No off target data available for this crispr