ID: 1021951867

View in Genome Browser
Species Human (GRCh38)
Location 7:25782933-25782955
Sequence CACATGGAAATGACTATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021951860_1021951867 30 Left 1021951860 7:25782880-25782902 CCACAGAAAAGGGATCATCTGAG No data
Right 1021951867 7:25782933-25782955 CACATGGAAATGACTATGAATGG No data
1021951865_1021951867 2 Left 1021951865 7:25782908-25782930 CCTTGAAGGGTGAGCTGGATTTC No data
Right 1021951867 7:25782933-25782955 CACATGGAAATGACTATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021951867 Original CRISPR CACATGGAAATGACTATGAA TGG Intergenic
No off target data available for this crispr