ID: 1021958240

View in Genome Browser
Species Human (GRCh38)
Location 7:25847817-25847839
Sequence TTGGCCAACCAGCCTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021958237_1021958240 -7 Left 1021958237 7:25847801-25847823 CCCTCAGTTGCTTACATTGGCCA No data
Right 1021958240 7:25847817-25847839 TTGGCCAACCAGCCTGAAATGGG No data
1021958238_1021958240 -8 Left 1021958238 7:25847802-25847824 CCTCAGTTGCTTACATTGGCCAA No data
Right 1021958240 7:25847817-25847839 TTGGCCAACCAGCCTGAAATGGG No data
1021958235_1021958240 -4 Left 1021958235 7:25847798-25847820 CCACCCTCAGTTGCTTACATTGG No data
Right 1021958240 7:25847817-25847839 TTGGCCAACCAGCCTGAAATGGG No data
1021958232_1021958240 22 Left 1021958232 7:25847772-25847794 CCTGTCTTATCTGTCCCTGATCT No data
Right 1021958240 7:25847817-25847839 TTGGCCAACCAGCCTGAAATGGG No data
1021958233_1021958240 8 Left 1021958233 7:25847786-25847808 CCCTGATCTCTGCCACCCTCAGT No data
Right 1021958240 7:25847817-25847839 TTGGCCAACCAGCCTGAAATGGG No data
1021958234_1021958240 7 Left 1021958234 7:25847787-25847809 CCTGATCTCTGCCACCCTCAGTT No data
Right 1021958240 7:25847817-25847839 TTGGCCAACCAGCCTGAAATGGG No data
1021958231_1021958240 23 Left 1021958231 7:25847771-25847793 CCCTGTCTTATCTGTCCCTGATC No data
Right 1021958240 7:25847817-25847839 TTGGCCAACCAGCCTGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021958240 Original CRISPR TTGGCCAACCAGCCTGAAAT GGG Intergenic
No off target data available for this crispr