ID: 1021958411

View in Genome Browser
Species Human (GRCh38)
Location 7:25849838-25849860
Sequence CAGGCCCACATGATGTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021958406_1021958411 27 Left 1021958406 7:25849788-25849810 CCTGAACTGCCAAACCAAACTCT No data
Right 1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG No data
1021958410_1021958411 -10 Left 1021958410 7:25849825-25849847 CCAGAGAGTGACTCAGGCCCACA No data
Right 1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG No data
1021958407_1021958411 18 Left 1021958407 7:25849797-25849819 CCAAACCAAACTCTGAGAAGCAG No data
Right 1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG No data
1021958408_1021958411 13 Left 1021958408 7:25849802-25849824 CCAAACTCTGAGAAGCAGATTCT No data
Right 1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021958411 Original CRISPR CAGGCCCACATGATGTTTGT TGG Intergenic
No off target data available for this crispr