ID: 1021958948

View in Genome Browser
Species Human (GRCh38)
Location 7:25853116-25853138
Sequence GTGTTTAAACAAATGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021958948_1021958952 0 Left 1021958948 7:25853116-25853138 CCCATCTCCATTTGTTTAAACAC No data
Right 1021958952 7:25853139-25853161 TTTTTGCCCCGTTTTCTGCAGGG No data
1021958948_1021958951 -1 Left 1021958948 7:25853116-25853138 CCCATCTCCATTTGTTTAAACAC No data
Right 1021958951 7:25853138-25853160 CTTTTTGCCCCGTTTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021958948 Original CRISPR GTGTTTAAACAAATGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr