ID: 1021958986

View in Genome Browser
Species Human (GRCh38)
Location 7:25853544-25853566
Sequence CCAGATCCTTAGTGTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021958986_1021958994 19 Left 1021958986 7:25853544-25853566 CCCTGCAGACACTAAGGATCTGG No data
Right 1021958994 7:25853586-25853608 CCCACAGTTAGGATGTCAGAGGG No data
1021958986_1021958991 8 Left 1021958986 7:25853544-25853566 CCCTGCAGACACTAAGGATCTGG No data
Right 1021958991 7:25853575-25853597 TAGAAAATTCACCCACAGTTAGG No data
1021958986_1021958992 18 Left 1021958986 7:25853544-25853566 CCCTGCAGACACTAAGGATCTGG No data
Right 1021958992 7:25853585-25853607 ACCCACAGTTAGGATGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021958986 Original CRISPR CCAGATCCTTAGTGTCTGCA GGG (reversed) Intergenic
No off target data available for this crispr