ID: 1021959859

View in Genome Browser
Species Human (GRCh38)
Location 7:25860451-25860473
Sequence GAAACCAAAGTGGAAACGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021959859_1021959863 -1 Left 1021959859 7:25860451-25860473 CCATGCGTTTCCACTTTGGTTTC No data
Right 1021959863 7:25860473-25860495 CTGAACCGAAGGAGGAGTGCCGG No data
1021959859_1021959865 4 Left 1021959859 7:25860451-25860473 CCATGCGTTTCCACTTTGGTTTC No data
Right 1021959865 7:25860478-25860500 CCGAAGGAGGAGTGCCGGCAAGG No data
1021959859_1021959868 24 Left 1021959859 7:25860451-25860473 CCATGCGTTTCCACTTTGGTTTC No data
Right 1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG No data
1021959859_1021959869 30 Left 1021959859 7:25860451-25860473 CCATGCGTTTCCACTTTGGTTTC No data
Right 1021959869 7:25860504-25860526 CGCCCGCAGTCCTGCGGTACAGG No data
1021959859_1021959866 5 Left 1021959859 7:25860451-25860473 CCATGCGTTTCCACTTTGGTTTC No data
Right 1021959866 7:25860479-25860501 CGAAGGAGGAGTGCCGGCAAGGG No data
1021959859_1021959862 -9 Left 1021959859 7:25860451-25860473 CCATGCGTTTCCACTTTGGTTTC No data
Right 1021959862 7:25860465-25860487 TTTGGTTTCTGAACCGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021959859 Original CRISPR GAAACCAAAGTGGAAACGCA TGG (reversed) Intergenic
No off target data available for this crispr