ID: 1021959860

View in Genome Browser
Species Human (GRCh38)
Location 7:25860461-25860483
Sequence CTTCGGTTCAGAAACCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021959860_1021959868 14 Left 1021959860 7:25860461-25860483 CCACTTTGGTTTCTGAACCGAAG No data
Right 1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG No data
1021959860_1021959870 21 Left 1021959860 7:25860461-25860483 CCACTTTGGTTTCTGAACCGAAG No data
Right 1021959870 7:25860505-25860527 GCCCGCAGTCCTGCGGTACAGGG No data
1021959860_1021959866 -5 Left 1021959860 7:25860461-25860483 CCACTTTGGTTTCTGAACCGAAG No data
Right 1021959866 7:25860479-25860501 CGAAGGAGGAGTGCCGGCAAGGG No data
1021959860_1021959865 -6 Left 1021959860 7:25860461-25860483 CCACTTTGGTTTCTGAACCGAAG No data
Right 1021959865 7:25860478-25860500 CCGAAGGAGGAGTGCCGGCAAGG No data
1021959860_1021959869 20 Left 1021959860 7:25860461-25860483 CCACTTTGGTTTCTGAACCGAAG No data
Right 1021959869 7:25860504-25860526 CGCCCGCAGTCCTGCGGTACAGG No data
1021959860_1021959873 25 Left 1021959860 7:25860461-25860483 CCACTTTGGTTTCTGAACCGAAG No data
Right 1021959873 7:25860509-25860531 GCAGTCCTGCGGTACAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021959860 Original CRISPR CTTCGGTTCAGAAACCAAAG TGG (reversed) Intergenic
No off target data available for this crispr