ID: 1021959864

View in Genome Browser
Species Human (GRCh38)
Location 7:25860478-25860500
Sequence CCTTGCCGGCACTCCTCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021959864_1021959868 -3 Left 1021959864 7:25860478-25860500 CCGAAGGAGGAGTGCCGGCAAGG No data
Right 1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG No data
1021959864_1021959870 4 Left 1021959864 7:25860478-25860500 CCGAAGGAGGAGTGCCGGCAAGG No data
Right 1021959870 7:25860505-25860527 GCCCGCAGTCCTGCGGTACAGGG No data
1021959864_1021959869 3 Left 1021959864 7:25860478-25860500 CCGAAGGAGGAGTGCCGGCAAGG No data
Right 1021959869 7:25860504-25860526 CGCCCGCAGTCCTGCGGTACAGG No data
1021959864_1021959873 8 Left 1021959864 7:25860478-25860500 CCGAAGGAGGAGTGCCGGCAAGG No data
Right 1021959873 7:25860509-25860531 GCAGTCCTGCGGTACAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021959864 Original CRISPR CCTTGCCGGCACTCCTCCTT CGG (reversed) Intergenic
No off target data available for this crispr