ID: 1021959868

View in Genome Browser
Species Human (GRCh38)
Location 7:25860498-25860520
Sequence AGGGAGCGCCCGCAGTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021959860_1021959868 14 Left 1021959860 7:25860461-25860483 CCACTTTGGTTTCTGAACCGAAG No data
Right 1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG No data
1021959864_1021959868 -3 Left 1021959864 7:25860478-25860500 CCGAAGGAGGAGTGCCGGCAAGG No data
Right 1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG No data
1021959859_1021959868 24 Left 1021959859 7:25860451-25860473 CCATGCGTTTCCACTTTGGTTTC No data
Right 1021959868 7:25860498-25860520 AGGGAGCGCCCGCAGTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021959868 Original CRISPR AGGGAGCGCCCGCAGTCCTG CGG Intergenic
No off target data available for this crispr