ID: 1021960233

View in Genome Browser
Species Human (GRCh38)
Location 7:25863158-25863180
Sequence ATTTTCCACTAGCAGAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021960228_1021960233 5 Left 1021960228 7:25863130-25863152 CCTTTGCTATGAATTCCCTGTCT No data
Right 1021960233 7:25863158-25863180 ATTTTCCACTAGCAGAGCTAGGG No data
1021960229_1021960233 -10 Left 1021960229 7:25863145-25863167 CCCTGTCTTCCTAATTTTCCACT No data
Right 1021960233 7:25863158-25863180 ATTTTCCACTAGCAGAGCTAGGG No data
1021960227_1021960233 27 Left 1021960227 7:25863108-25863130 CCTTCACTAGAATTCATTTTTTC No data
Right 1021960233 7:25863158-25863180 ATTTTCCACTAGCAGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021960233 Original CRISPR ATTTTCCACTAGCAGAGCTA GGG Intergenic
No off target data available for this crispr