ID: 1021961390

View in Genome Browser
Species Human (GRCh38)
Location 7:25876629-25876651
Sequence GCCTGTGCTAGCCTGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961390_1021961395 -2 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961395 7:25876650-25876672 GCACAGCTCCGTGGCCGGCAGGG No data
1021961390_1021961401 29 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961401 7:25876681-25876703 GTGGAACTTGCTTGGTTCTCTGG No data
1021961390_1021961400 21 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data
1021961390_1021961396 -1 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961396 7:25876651-25876673 CACAGCTCCGTGGCCGGCAGGGG No data
1021961390_1021961398 10 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961398 7:25876662-25876684 GGCCGGCAGGGGAAGCACAGTGG No data
1021961390_1021961393 -7 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961393 7:25876645-25876667 CACAGGCACAGCTCCGTGGCCGG No data
1021961390_1021961394 -3 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961394 7:25876649-25876671 GGCACAGCTCCGTGGCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961390 Original CRISPR GCCTGTGCTAGCCTGCTAGA GGG (reversed) Intergenic