ID: 1021961391

View in Genome Browser
Species Human (GRCh38)
Location 7:25876630-25876652
Sequence TGCCTGTGCTAGCCTGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961391_1021961396 -2 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961396 7:25876651-25876673 CACAGCTCCGTGGCCGGCAGGGG No data
1021961391_1021961394 -4 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961394 7:25876649-25876671 GGCACAGCTCCGTGGCCGGCAGG No data
1021961391_1021961395 -3 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961395 7:25876650-25876672 GCACAGCTCCGTGGCCGGCAGGG No data
1021961391_1021961398 9 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961398 7:25876662-25876684 GGCCGGCAGGGGAAGCACAGTGG No data
1021961391_1021961400 20 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data
1021961391_1021961393 -8 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961393 7:25876645-25876667 CACAGGCACAGCTCCGTGGCCGG No data
1021961391_1021961401 28 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961401 7:25876681-25876703 GTGGAACTTGCTTGGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961391 Original CRISPR TGCCTGTGCTAGCCTGCTAG AGG (reversed) Intergenic