ID: 1021961397

View in Genome Browser
Species Human (GRCh38)
Location 7:25876658-25876680
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961397_1021961403 17 Left 1021961397 7:25876658-25876680 CCGTGGCCGGCAGGGGAAGCACA No data
Right 1021961403 7:25876698-25876720 CTCTGGAGTCTAGACTCGGCTGG No data
1021961397_1021961400 -8 Left 1021961397 7:25876658-25876680 CCGTGGCCGGCAGGGGAAGCACA No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data
1021961397_1021961401 0 Left 1021961397 7:25876658-25876680 CCGTGGCCGGCAGGGGAAGCACA No data
Right 1021961401 7:25876681-25876703 GTGGAACTTGCTTGGTTCTCTGG No data
1021961397_1021961402 13 Left 1021961397 7:25876658-25876680 CCGTGGCCGGCAGGGGAAGCACA No data
Right 1021961402 7:25876694-25876716 GGTTCTCTGGAGTCTAGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961397 Original CRISPR TGTGCTTCCCCTGCCGGCCA CGG (reversed) Intergenic