ID: 1021961399

View in Genome Browser
Species Human (GRCh38)
Location 7:25876664-25876686
Sequence TTCCACTGTGCTTCCCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 429}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961399_1021961402 7 Left 1021961399 7:25876664-25876686 CCGGCAGGGGAAGCACAGTGGAA 0: 1
1: 0
2: 3
3: 30
4: 429
Right 1021961402 7:25876694-25876716 GGTTCTCTGGAGTCTAGACTCGG No data
1021961399_1021961403 11 Left 1021961399 7:25876664-25876686 CCGGCAGGGGAAGCACAGTGGAA 0: 1
1: 0
2: 3
3: 30
4: 429
Right 1021961403 7:25876698-25876720 CTCTGGAGTCTAGACTCGGCTGG No data
1021961399_1021961401 -6 Left 1021961399 7:25876664-25876686 CCGGCAGGGGAAGCACAGTGGAA 0: 1
1: 0
2: 3
3: 30
4: 429
Right 1021961401 7:25876681-25876703 GTGGAACTTGCTTGGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961399 Original CRISPR TTCCACTGTGCTTCCCCTGC CGG (reversed) Intergenic