ID: 1021961400

View in Genome Browser
Species Human (GRCh38)
Location 7:25876673-25876695
Sequence GAAGCACAGTGGAACTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961390_1021961400 21 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data
1021961391_1021961400 20 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data
1021961397_1021961400 -8 Left 1021961397 7:25876658-25876680 CCGTGGCCGGCAGGGGAAGCACA No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data
1021961386_1021961400 27 Left 1021961386 7:25876623-25876645 CCCCATCCCTCTAGCAGGCTAGC No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data
1021961387_1021961400 26 Left 1021961387 7:25876624-25876646 CCCATCCCTCTAGCAGGCTAGCA No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data
1021961388_1021961400 25 Left 1021961388 7:25876625-25876647 CCATCCCTCTAGCAGGCTAGCAC No data
Right 1021961400 7:25876673-25876695 GAAGCACAGTGGAACTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961400 Original CRISPR GAAGCACAGTGGAACTTGCT TGG Intergenic