ID: 1021961401

View in Genome Browser
Species Human (GRCh38)
Location 7:25876681-25876703
Sequence GTGGAACTTGCTTGGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961390_1021961401 29 Left 1021961390 7:25876629-25876651 CCCTCTAGCAGGCTAGCACAGGC No data
Right 1021961401 7:25876681-25876703 GTGGAACTTGCTTGGTTCTCTGG No data
1021961397_1021961401 0 Left 1021961397 7:25876658-25876680 CCGTGGCCGGCAGGGGAAGCACA No data
Right 1021961401 7:25876681-25876703 GTGGAACTTGCTTGGTTCTCTGG No data
1021961391_1021961401 28 Left 1021961391 7:25876630-25876652 CCTCTAGCAGGCTAGCACAGGCA No data
Right 1021961401 7:25876681-25876703 GTGGAACTTGCTTGGTTCTCTGG No data
1021961399_1021961401 -6 Left 1021961399 7:25876664-25876686 CCGGCAGGGGAAGCACAGTGGAA No data
Right 1021961401 7:25876681-25876703 GTGGAACTTGCTTGGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961401 Original CRISPR GTGGAACTTGCTTGGTTCTC TGG Intergenic