ID: 1021961402

View in Genome Browser
Species Human (GRCh38)
Location 7:25876694-25876716
Sequence GGTTCTCTGGAGTCTAGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961397_1021961402 13 Left 1021961397 7:25876658-25876680 CCGTGGCCGGCAGGGGAAGCACA No data
Right 1021961402 7:25876694-25876716 GGTTCTCTGGAGTCTAGACTCGG No data
1021961399_1021961402 7 Left 1021961399 7:25876664-25876686 CCGGCAGGGGAAGCACAGTGGAA No data
Right 1021961402 7:25876694-25876716 GGTTCTCTGGAGTCTAGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961402 Original CRISPR GGTTCTCTGGAGTCTAGACT CGG Intergenic