ID: 1021961403

View in Genome Browser
Species Human (GRCh38)
Location 7:25876698-25876720
Sequence CTCTGGAGTCTAGACTCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961399_1021961403 11 Left 1021961399 7:25876664-25876686 CCGGCAGGGGAAGCACAGTGGAA No data
Right 1021961403 7:25876698-25876720 CTCTGGAGTCTAGACTCGGCTGG No data
1021961397_1021961403 17 Left 1021961397 7:25876658-25876680 CCGTGGCCGGCAGGGGAAGCACA No data
Right 1021961403 7:25876698-25876720 CTCTGGAGTCTAGACTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961403 Original CRISPR CTCTGGAGTCTAGACTCGGC TGG Intergenic