ID: 1021961938

View in Genome Browser
Species Human (GRCh38)
Location 7:25881654-25881676
Sequence TACACAAGGCGGCTGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021961932_1021961938 -4 Left 1021961932 7:25881635-25881657 CCCAGCAGGGACTGGGAGATACA No data
Right 1021961938 7:25881654-25881676 TACACAAGGCGGCTGAAGGAGGG No data
1021961933_1021961938 -5 Left 1021961933 7:25881636-25881658 CCAGCAGGGACTGGGAGATACAC No data
Right 1021961938 7:25881654-25881676 TACACAAGGCGGCTGAAGGAGGG No data
1021961931_1021961938 1 Left 1021961931 7:25881630-25881652 CCAAGCCCAGCAGGGACTGGGAG No data
Right 1021961938 7:25881654-25881676 TACACAAGGCGGCTGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021961938 Original CRISPR TACACAAGGCGGCTGAAGGA GGG Intergenic
No off target data available for this crispr