ID: 1021969328

View in Genome Browser
Species Human (GRCh38)
Location 7:25951305-25951327
Sequence CGGGGCGCACGTGACCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021969328_1021969348 26 Left 1021969328 7:25951305-25951327 CCCCCGGGGTCACGTGCGCCCCG No data
Right 1021969348 7:25951354-25951376 GCAAATAGAGCGGCCGCGCGGGG No data
1021969328_1021969346 24 Left 1021969328 7:25951305-25951327 CCCCCGGGGTCACGTGCGCCCCG No data
Right 1021969346 7:25951352-25951374 ATGCAAATAGAGCGGCCGCGCGG No data
1021969328_1021969349 30 Left 1021969328 7:25951305-25951327 CCCCCGGGGTCACGTGCGCCCCG No data
Right 1021969349 7:25951358-25951380 ATAGAGCGGCCGCGCGGGGCTGG No data
1021969328_1021969347 25 Left 1021969328 7:25951305-25951327 CCCCCGGGGTCACGTGCGCCCCG No data
Right 1021969347 7:25951353-25951375 TGCAAATAGAGCGGCCGCGCGGG No data
1021969328_1021969343 16 Left 1021969328 7:25951305-25951327 CCCCCGGGGTCACGTGCGCCCCG No data
Right 1021969343 7:25951344-25951366 GCCTCCTTATGCAAATAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021969328 Original CRISPR CGGGGCGCACGTGACCCCGG GGG (reversed) Intergenic
No off target data available for this crispr