ID: 1021972765

View in Genome Browser
Species Human (GRCh38)
Location 7:25981664-25981686
Sequence CTGTCTTAGCAAAGGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021972765_1021972772 7 Left 1021972765 7:25981664-25981686 CCTCTTTCCCTTTGCTAAGACAG No data
Right 1021972772 7:25981694-25981716 TTTGTTCGCTGTCCTCTAGCGGG No data
1021972765_1021972777 23 Left 1021972765 7:25981664-25981686 CCTCTTTCCCTTTGCTAAGACAG No data
Right 1021972777 7:25981710-25981732 TAGCGGGGCGACGACATCAGGGG No data
1021972765_1021972779 30 Left 1021972765 7:25981664-25981686 CCTCTTTCCCTTTGCTAAGACAG No data
Right 1021972779 7:25981717-25981739 GCGACGACATCAGGGGAGGCTGG No data
1021972765_1021972778 26 Left 1021972765 7:25981664-25981686 CCTCTTTCCCTTTGCTAAGACAG No data
Right 1021972778 7:25981713-25981735 CGGGGCGACGACATCAGGGGAGG No data
1021972765_1021972775 21 Left 1021972765 7:25981664-25981686 CCTCTTTCCCTTTGCTAAGACAG No data
Right 1021972775 7:25981708-25981730 TCTAGCGGGGCGACGACATCAGG No data
1021972765_1021972771 6 Left 1021972765 7:25981664-25981686 CCTCTTTCCCTTTGCTAAGACAG No data
Right 1021972771 7:25981693-25981715 TTTTGTTCGCTGTCCTCTAGCGG No data
1021972765_1021972776 22 Left 1021972765 7:25981664-25981686 CCTCTTTCCCTTTGCTAAGACAG No data
Right 1021972776 7:25981709-25981731 CTAGCGGGGCGACGACATCAGGG No data
1021972765_1021972773 8 Left 1021972765 7:25981664-25981686 CCTCTTTCCCTTTGCTAAGACAG No data
Right 1021972773 7:25981695-25981717 TTGTTCGCTGTCCTCTAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021972765 Original CRISPR CTGTCTTAGCAAAGGGAAAG AGG (reversed) Intergenic
No off target data available for this crispr