ID: 1021976055

View in Genome Browser
Species Human (GRCh38)
Location 7:26012185-26012207
Sequence CTATTTCCAGAGGTGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021976047_1021976055 -1 Left 1021976047 7:26012163-26012185 CCCAGAACACCAGCAATGACCCC No data
Right 1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG No data
1021976045_1021976055 1 Left 1021976045 7:26012161-26012183 CCCCCAGAACACCAGCAATGACC No data
Right 1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG No data
1021976049_1021976055 -10 Left 1021976049 7:26012172-26012194 CCAGCAATGACCCCTATTTCCAG No data
Right 1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG No data
1021976046_1021976055 0 Left 1021976046 7:26012162-26012184 CCCCAGAACACCAGCAATGACCC No data
Right 1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG No data
1021976044_1021976055 10 Left 1021976044 7:26012152-26012174 CCTATGACTCCCCCAGAACACCA No data
Right 1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG No data
1021976048_1021976055 -2 Left 1021976048 7:26012164-26012186 CCAGAACACCAGCAATGACCCCT No data
Right 1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG No data
1021976043_1021976055 21 Left 1021976043 7:26012141-26012163 CCAGAGAGCATCCTATGACTCCC No data
Right 1021976055 7:26012185-26012207 CTATTTCCAGAGGTGGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021976055 Original CRISPR CTATTTCCAGAGGTGGAGTT TGG Intergenic
No off target data available for this crispr