ID: 1021980401

View in Genome Browser
Species Human (GRCh38)
Location 7:26048599-26048621
Sequence TCCTGTTTTACATACCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021980401_1021980405 20 Left 1021980401 7:26048599-26048621 CCTGGGAGGTATGTAAAACAGGA No data
Right 1021980405 7:26048642-26048664 GAGGTCAAATGACTTGCCCAAGG No data
1021980401_1021980404 1 Left 1021980401 7:26048599-26048621 CCTGGGAGGTATGTAAAACAGGA No data
Right 1021980404 7:26048623-26048645 AAGAAACTGAGGCTCAAAGGAGG No data
1021980401_1021980402 -10 Left 1021980401 7:26048599-26048621 CCTGGGAGGTATGTAAAACAGGA No data
Right 1021980402 7:26048612-26048634 TAAAACAGGAGAAGAAACTGAGG No data
1021980401_1021980403 -2 Left 1021980401 7:26048599-26048621 CCTGGGAGGTATGTAAAACAGGA No data
Right 1021980403 7:26048620-26048642 GAGAAGAAACTGAGGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021980401 Original CRISPR TCCTGTTTTACATACCTCCC AGG (reversed) Intergenic
No off target data available for this crispr