ID: 1021983670

View in Genome Browser
Species Human (GRCh38)
Location 7:26079117-26079139
Sequence CGCGGGCGGTGTGGGCGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021983670_1021983678 2 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983678 7:26079142-26079164 TGCCCTGTGCCCGCGGGATCAGG No data
1021983670_1021983685 12 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983685 7:26079152-26079174 CCGCGGGATCAGGTGTAGCGGGG No data
1021983670_1021983676 -5 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983676 7:26079135-26079157 CCGCGCATGCCCTGTGCCCGCGG No data
1021983670_1021983681 10 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983681 7:26079150-26079172 GCCCGCGGGATCAGGTGTAGCGG No data
1021983670_1021983677 -4 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983677 7:26079136-26079158 CGCGCATGCCCTGTGCCCGCGGG No data
1021983670_1021983683 11 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983683 7:26079151-26079173 CCCGCGGGATCAGGTGTAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021983670 Original CRISPR CGCGGGCGGTGTGGGCGCGT CGG (reversed) Intergenic
No off target data available for this crispr