ID: 1021983677

View in Genome Browser
Species Human (GRCh38)
Location 7:26079136-26079158
Sequence CGCGCATGCCCTGTGCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021983670_1021983677 -4 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983677 7:26079136-26079158 CGCGCATGCCCTGTGCCCGCGGG No data
1021983669_1021983677 -3 Left 1021983669 7:26079116-26079138 CCCGACGCGCCCACACCGCCCGC No data
Right 1021983677 7:26079136-26079158 CGCGCATGCCCTGTGCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021983677 Original CRISPR CGCGCATGCCCTGTGCCCGC GGG Intergenic
No off target data available for this crispr