ID: 1021983678

View in Genome Browser
Species Human (GRCh38)
Location 7:26079142-26079164
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021983671_1021983678 -6 Left 1021983671 7:26079125-26079147 CCCACACCGCCCGCGCATGCCCT No data
Right 1021983678 7:26079142-26079164 TGCCCTGTGCCCGCGGGATCAGG 0: 1
1: 0
2: 1
3: 9
4: 112
1021983670_1021983678 2 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983678 7:26079142-26079164 TGCCCTGTGCCCGCGGGATCAGG 0: 1
1: 0
2: 1
3: 9
4: 112
1021983669_1021983678 3 Left 1021983669 7:26079116-26079138 CCCGACGCGCCCACACCGCCCGC No data
Right 1021983678 7:26079142-26079164 TGCCCTGTGCCCGCGGGATCAGG 0: 1
1: 0
2: 1
3: 9
4: 112
1021983672_1021983678 -7 Left 1021983672 7:26079126-26079148 CCACACCGCCCGCGCATGCCCTG No data
Right 1021983678 7:26079142-26079164 TGCCCTGTGCCCGCGGGATCAGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021983678 Original CRISPR TGCCCTGTGCCCGCGGGATC AGG Intergenic