ID: 1021983681

View in Genome Browser
Species Human (GRCh38)
Location 7:26079150-26079172
Sequence GCCCGCGGGATCAGGTGTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021983673_1021983681 -4 Left 1021983673 7:26079131-26079153 CCGCCCGCGCATGCCCTGTGCCC No data
Right 1021983681 7:26079150-26079172 GCCCGCGGGATCAGGTGTAGCGG No data
1021983672_1021983681 1 Left 1021983672 7:26079126-26079148 CCACACCGCCCGCGCATGCCCTG No data
Right 1021983681 7:26079150-26079172 GCCCGCGGGATCAGGTGTAGCGG No data
1021983675_1021983681 -8 Left 1021983675 7:26079135-26079157 CCGCGCATGCCCTGTGCCCGCGG No data
Right 1021983681 7:26079150-26079172 GCCCGCGGGATCAGGTGTAGCGG No data
1021983669_1021983681 11 Left 1021983669 7:26079116-26079138 CCCGACGCGCCCACACCGCCCGC No data
Right 1021983681 7:26079150-26079172 GCCCGCGGGATCAGGTGTAGCGG No data
1021983674_1021983681 -7 Left 1021983674 7:26079134-26079156 CCCGCGCATGCCCTGTGCCCGCG No data
Right 1021983681 7:26079150-26079172 GCCCGCGGGATCAGGTGTAGCGG No data
1021983670_1021983681 10 Left 1021983670 7:26079117-26079139 CCGACGCGCCCACACCGCCCGCG No data
Right 1021983681 7:26079150-26079172 GCCCGCGGGATCAGGTGTAGCGG No data
1021983671_1021983681 2 Left 1021983671 7:26079125-26079147 CCCACACCGCCCGCGCATGCCCT No data
Right 1021983681 7:26079150-26079172 GCCCGCGGGATCAGGTGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021983681 Original CRISPR GCCCGCGGGATCAGGTGTAG CGG Intergenic
No off target data available for this crispr