ID: 1021986332

View in Genome Browser
Species Human (GRCh38)
Location 7:26101567-26101589
Sequence TGGTGGCCCCTGCCTACCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986332_1021986339 18 Left 1021986332 7:26101567-26101589 CCGAGGGTAGGCAGGGGCCACCA No data
Right 1021986339 7:26101608-26101630 GTTTCAGGAAGTACGATAGCAGG No data
1021986332_1021986335 3 Left 1021986332 7:26101567-26101589 CCGAGGGTAGGCAGGGGCCACCA No data
Right 1021986335 7:26101593-26101615 TGCGTGACCCCTGCAGTTTCAGG No data
1021986332_1021986341 25 Left 1021986332 7:26101567-26101589 CCGAGGGTAGGCAGGGGCCACCA No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986332_1021986340 24 Left 1021986332 7:26101567-26101589 CCGAGGGTAGGCAGGGGCCACCA No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986332 Original CRISPR TGGTGGCCCCTGCCTACCCT CGG (reversed) Intergenic