ID: 1021986333

View in Genome Browser
Species Human (GRCh38)
Location 7:26101584-26101606
Sequence GCAGGGGTCACGCAGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986333_1021986340 7 Left 1021986333 7:26101584-26101606 CCACCAGTCTGCGTGACCCCTGC No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data
1021986333_1021986341 8 Left 1021986333 7:26101584-26101606 CCACCAGTCTGCGTGACCCCTGC No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986333_1021986339 1 Left 1021986333 7:26101584-26101606 CCACCAGTCTGCGTGACCCCTGC No data
Right 1021986339 7:26101608-26101630 GTTTCAGGAAGTACGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986333 Original CRISPR GCAGGGGTCACGCAGACTGG TGG (reversed) Intergenic