ID: 1021986334

View in Genome Browser
Species Human (GRCh38)
Location 7:26101587-26101609
Sequence ACTGCAGGGGTCACGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986334_1021986339 -2 Left 1021986334 7:26101587-26101609 CCAGTCTGCGTGACCCCTGCAGT No data
Right 1021986339 7:26101608-26101630 GTTTCAGGAAGTACGATAGCAGG No data
1021986334_1021986341 5 Left 1021986334 7:26101587-26101609 CCAGTCTGCGTGACCCCTGCAGT No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986334_1021986340 4 Left 1021986334 7:26101587-26101609 CCAGTCTGCGTGACCCCTGCAGT No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986334 Original CRISPR ACTGCAGGGGTCACGCAGAC TGG (reversed) Intergenic