ID: 1021986335

View in Genome Browser
Species Human (GRCh38)
Location 7:26101593-26101615
Sequence TGCGTGACCCCTGCAGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986332_1021986335 3 Left 1021986332 7:26101567-26101589 CCGAGGGTAGGCAGGGGCCACCA No data
Right 1021986335 7:26101593-26101615 TGCGTGACCCCTGCAGTTTCAGG No data
1021986322_1021986335 29 Left 1021986322 7:26101541-26101563 CCAGCGTGGCTGCTTAGACAGCG No data
Right 1021986335 7:26101593-26101615 TGCGTGACCCCTGCAGTTTCAGG No data
1021986321_1021986335 30 Left 1021986321 7:26101540-26101562 CCCAGCGTGGCTGCTTAGACAGC No data
Right 1021986335 7:26101593-26101615 TGCGTGACCCCTGCAGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986335 Original CRISPR TGCGTGACCCCTGCAGTTTC AGG Intergenic