ID: 1021986336

View in Genome Browser
Species Human (GRCh38)
Location 7:26101600-26101622
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986336_1021986340 -9 Left 1021986336 7:26101600-26101622 CCCCTGCAGTTTCAGGAAGTACG No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data
1021986336_1021986341 -8 Left 1021986336 7:26101600-26101622 CCCCTGCAGTTTCAGGAAGTACG No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG 0: 1
1: 0
2: 1
3: 3
4: 96
1021986336_1021986342 20 Left 1021986336 7:26101600-26101622 CCCCTGCAGTTTCAGGAAGTACG No data
Right 1021986342 7:26101643-26101665 CTCAGATGAGACCCAAGTCCAGG No data
1021986336_1021986343 21 Left 1021986336 7:26101600-26101622 CCCCTGCAGTTTCAGGAAGTACG No data
Right 1021986343 7:26101644-26101666 TCAGATGAGACCCAAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986336 Original CRISPR CGTACTTCCTGAAACTGCAG GGG (reversed) Intergenic