ID: 1021986337

View in Genome Browser
Species Human (GRCh38)
Location 7:26101601-26101623
Sequence TCGTACTTCCTGAAACTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986337_1021986342 19 Left 1021986337 7:26101601-26101623 CCCTGCAGTTTCAGGAAGTACGA No data
Right 1021986342 7:26101643-26101665 CTCAGATGAGACCCAAGTCCAGG No data
1021986337_1021986341 -9 Left 1021986337 7:26101601-26101623 CCCTGCAGTTTCAGGAAGTACGA No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986337_1021986343 20 Left 1021986337 7:26101601-26101623 CCCTGCAGTTTCAGGAAGTACGA No data
Right 1021986343 7:26101644-26101666 TCAGATGAGACCCAAGTCCAGGG No data
1021986337_1021986340 -10 Left 1021986337 7:26101601-26101623 CCCTGCAGTTTCAGGAAGTACGA No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data
1021986337_1021986345 30 Left 1021986337 7:26101601-26101623 CCCTGCAGTTTCAGGAAGTACGA No data
Right 1021986345 7:26101654-26101676 CCCAAGTCCAGGGTGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986337 Original CRISPR TCGTACTTCCTGAAACTGCA GGG (reversed) Intergenic