ID: 1021986338

View in Genome Browser
Species Human (GRCh38)
Location 7:26101602-26101624
Sequence ATCGTACTTCCTGAAACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986338_1021986345 29 Left 1021986338 7:26101602-26101624 CCTGCAGTTTCAGGAAGTACGAT No data
Right 1021986345 7:26101654-26101676 CCCAAGTCCAGGGTGCAGCCTGG No data
1021986338_1021986342 18 Left 1021986338 7:26101602-26101624 CCTGCAGTTTCAGGAAGTACGAT No data
Right 1021986342 7:26101643-26101665 CTCAGATGAGACCCAAGTCCAGG No data
1021986338_1021986341 -10 Left 1021986338 7:26101602-26101624 CCTGCAGTTTCAGGAAGTACGAT No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986338_1021986343 19 Left 1021986338 7:26101602-26101624 CCTGCAGTTTCAGGAAGTACGAT No data
Right 1021986343 7:26101644-26101666 TCAGATGAGACCCAAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986338 Original CRISPR ATCGTACTTCCTGAAACTGC AGG (reversed) Intergenic