ID: 1021986339

View in Genome Browser
Species Human (GRCh38)
Location 7:26101608-26101630
Sequence GTTTCAGGAAGTACGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986334_1021986339 -2 Left 1021986334 7:26101587-26101609 CCAGTCTGCGTGACCCCTGCAGT No data
Right 1021986339 7:26101608-26101630 GTTTCAGGAAGTACGATAGCAGG No data
1021986332_1021986339 18 Left 1021986332 7:26101567-26101589 CCGAGGGTAGGCAGGGGCCACCA No data
Right 1021986339 7:26101608-26101630 GTTTCAGGAAGTACGATAGCAGG No data
1021986333_1021986339 1 Left 1021986333 7:26101584-26101606 CCACCAGTCTGCGTGACCCCTGC No data
Right 1021986339 7:26101608-26101630 GTTTCAGGAAGTACGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986339 Original CRISPR GTTTCAGGAAGTACGATAGC AGG Intergenic