ID: 1021986340

View in Genome Browser
Species Human (GRCh38)
Location 7:26101614-26101636
Sequence GGAAGTACGATAGCAGGAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986332_1021986340 24 Left 1021986332 7:26101567-26101589 CCGAGGGTAGGCAGGGGCCACCA No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data
1021986333_1021986340 7 Left 1021986333 7:26101584-26101606 CCACCAGTCTGCGTGACCCCTGC No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data
1021986334_1021986340 4 Left 1021986334 7:26101587-26101609 CCAGTCTGCGTGACCCCTGCAGT No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data
1021986337_1021986340 -10 Left 1021986337 7:26101601-26101623 CCCTGCAGTTTCAGGAAGTACGA No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data
1021986336_1021986340 -9 Left 1021986336 7:26101600-26101622 CCCCTGCAGTTTCAGGAAGTACG No data
Right 1021986340 7:26101614-26101636 GGAAGTACGATAGCAGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986340 Original CRISPR GGAAGTACGATAGCAGGAAA CGG Intergenic