ID: 1021986341

View in Genome Browser
Species Human (GRCh38)
Location 7:26101615-26101637
Sequence GAAGTACGATAGCAGGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986333_1021986341 8 Left 1021986333 7:26101584-26101606 CCACCAGTCTGCGTGACCCCTGC No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986337_1021986341 -9 Left 1021986337 7:26101601-26101623 CCCTGCAGTTTCAGGAAGTACGA No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986332_1021986341 25 Left 1021986332 7:26101567-26101589 CCGAGGGTAGGCAGGGGCCACCA No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986338_1021986341 -10 Left 1021986338 7:26101602-26101624 CCTGCAGTTTCAGGAAGTACGAT No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986334_1021986341 5 Left 1021986334 7:26101587-26101609 CCAGTCTGCGTGACCCCTGCAGT No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data
1021986336_1021986341 -8 Left 1021986336 7:26101600-26101622 CCCCTGCAGTTTCAGGAAGTACG No data
Right 1021986341 7:26101615-26101637 GAAGTACGATAGCAGGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986341 Original CRISPR GAAGTACGATAGCAGGAAAC GGG Intergenic