ID: 1021986345

View in Genome Browser
Species Human (GRCh38)
Location 7:26101654-26101676
Sequence CCCAAGTCCAGGGTGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021986337_1021986345 30 Left 1021986337 7:26101601-26101623 CCCTGCAGTTTCAGGAAGTACGA No data
Right 1021986345 7:26101654-26101676 CCCAAGTCCAGGGTGCAGCCTGG No data
1021986338_1021986345 29 Left 1021986338 7:26101602-26101624 CCTGCAGTTTCAGGAAGTACGAT No data
Right 1021986345 7:26101654-26101676 CCCAAGTCCAGGGTGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021986345 Original CRISPR CCCAAGTCCAGGGTGCAGCC TGG Intergenic