ID: 1021993532

View in Genome Browser
Species Human (GRCh38)
Location 7:26158628-26158650
Sequence CTCTGTAACCTACTAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021993532 Original CRISPR CTCTGTAACCTACTAATGGA GGG (reversed) Intronic
900333903 1:2151373-2151395 CTCTGCAACCTTCTCATGTATGG + Intronic
900880658 1:5378911-5378933 CTCAGTAAGCTAAAAATGGAAGG + Intergenic
901076872 1:6560628-6560650 CTCTATTACCTATTAAAGGATGG - Intronic
902141826 1:14363209-14363231 CTCTATAAACTACTCCTGGAAGG + Intergenic
909423425 1:75492974-75492996 CTTTGTAACCAGCTAAAGGAAGG - Intronic
910298150 1:85673817-85673839 CTCTGTAACATACTCATGAATGG - Intronic
912781214 1:112549963-112549985 CTCAGTAAACTACAAATTGAAGG - Intronic
913473857 1:119217786-119217808 TTCTGTTACCTGCTAATGGGAGG - Intergenic
916191532 1:162183642-162183664 CTCTGTAACATAAAAATGGAAGG - Intronic
919242559 1:194934264-194934286 CACTGTGAACTACTAAAGGATGG + Intergenic
920906540 1:210175020-210175042 TTCTGTAACCAGCTAATGCATGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1064788335 10:18925109-18925131 CTCTGTAACATAGAAATGTAAGG - Intergenic
1068720648 10:60242141-60242163 GTCTCTAACCTACTCCTGGAAGG + Intronic
1069262248 10:66413366-66413388 CTATGTAACCTTCTAGTGCAGGG - Intronic
1071079621 10:81795247-81795269 CTTTGTAACCTAATAATTGCTGG + Intergenic
1073275034 10:102302470-102302492 ATCTGTGACCTTCCAATGGAAGG + Intronic
1077084812 11:744218-744240 CTCTGTGACCTAGAAGTGGAAGG - Intergenic
1078805624 11:14698207-14698229 CTTGGTAACCTAGGAATGGAAGG - Intronic
1080638910 11:34147160-34147182 CTCTGTTCCCAACAAATGGAAGG - Intronic
1080897678 11:36459880-36459902 CTCTGGAACTTAGTAATGGCTGG - Intronic
1085210996 11:74778286-74778308 CTCTTTAACCTACTAATCTCTGG + Intronic
1085532249 11:77198768-77198790 CTCTGGCACCTCCTAGTGGAGGG + Intronic
1088162995 11:106896283-106896305 CTCAGTAAACTAGTAATGAAGGG + Intronic
1093136735 12:15461117-15461139 CTCTGAAGCCTACTAACTGAAGG + Intronic
1093550518 12:20404804-20404826 CTCTGTAACCTACACATGTGTGG - Intronic
1098556289 12:71822623-71822645 ATCTGTATTCTACAAATGGAAGG + Intergenic
1099488928 12:83263581-83263603 CTCTGTGATCTACTAATTGTTGG - Intergenic
1100124285 12:91405159-91405181 ATCTGGAACCCACTAATTGAAGG + Intergenic
1105954242 13:25265023-25265045 CTTTGTAGCCTACTAATAGAAGG - Intronic
1108483674 13:50902562-50902584 CTCTGTCACCTTCTTGTGGATGG - Intergenic
1108518645 13:51224772-51224794 CTCTGTTATCTACAAATGCAAGG + Intronic
1114656411 14:24318560-24318582 CTCAGTCACCTACAATTGGAGGG + Exonic
1118066466 14:62196628-62196650 CTCAGTAAACTACGAATAGATGG - Intergenic
1118966111 14:70587186-70587208 CTGTGTAACCTCTTAAGGGAAGG + Intronic
1124909022 15:33899857-33899879 CTCTGGAACATACTTCTGGAAGG - Intronic
1125415356 15:39446875-39446897 CTCTGTAACCTTCTTACAGATGG + Intergenic
1132323884 15:100949829-100949851 CTCAGTAAACTAGTAATAGAAGG + Intronic
1134841279 16:17403950-17403972 GTCTCTAACCTGCTAGTGGATGG - Intronic
1135264792 16:21014424-21014446 CTCAGTAAACTAGTAATAGAGGG + Intronic
1139133382 16:64172964-64172986 CTTTTTAACCTAGCAATGGAGGG + Intergenic
1141411969 16:83841262-83841284 CTCTGAAACCTACTACCTGAGGG - Intergenic
1144277947 17:13693786-13693808 CTCTATAACCTAGTAACAGAGGG - Intergenic
1146142978 17:30385555-30385577 ATCTGCAACCTACTTTTGGATGG - Intronic
1148663697 17:49358829-49358851 ATCTGAAACCTCCTAAGGGAAGG + Intronic
1150214959 17:63462232-63462254 CTCTGTCATCTTCTCATGGATGG - Intergenic
1156362146 18:36392530-36392552 CTCTGTCCCCTACTCAGGGAGGG - Intronic
1159663855 18:71132595-71132617 CTCTCTTACCTAATATTGGAAGG + Intergenic
1161624596 19:5319015-5319037 TTCTGGAAACTTCTAATGGAAGG + Intronic
1164229163 19:23272990-23273012 CTCTGTGACTTCCTAATGTATGG - Intergenic
1164243959 19:23414833-23414855 CTCTGTGACTTCCTAATGTATGG - Intergenic
1164280503 19:23764204-23764226 CTCTGTGACTTCCTAATGTATGG + Intronic
926318945 2:11734619-11734641 CTCTTTTACCTTCTCATGGAAGG + Intronic
933359425 2:81260381-81260403 TTTTGTAACCTACTAATGGGTGG + Intergenic
933518491 2:83337551-83337573 CTCTGTCACTTACTAGTAGAAGG + Intergenic
933882625 2:86685598-86685620 ATCTGTCAACTACTAATAGAGGG + Intronic
934591720 2:95557933-95557955 CTCTGTATCCTACACAAGGAGGG - Intergenic
935471427 2:103465067-103465089 CTCTCTCACGAACTAATGGAGGG - Intergenic
936069954 2:109360997-109361019 CTCAGTAAACTACAAATAGAGGG - Intronic
939612558 2:144328573-144328595 CTCTGTCACCTACAACGGGAAGG - Intronic
944080754 2:195785562-195785584 CTCAGTAAACTAGGAATGGAGGG - Intronic
944652054 2:201840353-201840375 CTTTTTAACCTACCAATGAAAGG + Intronic
1171943249 20:31351322-31351344 CTCTGTCACTTATTAATGAAGGG + Intergenic
1179306667 21:40159887-40159909 TTCAGTAACCTAATAATAGATGG - Intronic
1184078048 22:42196099-42196121 CTGTGTAACCTGCAAAGGGAAGG + Intronic
1184624316 22:45711455-45711477 CTCTGTAACTTAATAATGCAGGG - Intronic
949386873 3:3512728-3512750 CACTGTAAACTACTAGAGGATGG + Intergenic
950807481 3:15619209-15619231 CTCAGTAAACTACGAATAGAGGG - Intronic
951603413 3:24402116-24402138 CTCTGTAACATCCTGATGGTGGG - Intronic
959150867 3:102605990-102606012 CTCTGGAAGCTACTATTGGATGG - Intergenic
962272493 3:133988242-133988264 CTCTGAAGCCTACTACTTGAAGG + Intronic
962622647 3:137195177-137195199 CTCTGTAACCTGCCCAAGGATGG - Intergenic
963208053 3:142656731-142656753 ATCTGTAAACTTGTAATGGAGGG + Intronic
964628574 3:158783628-158783650 CACTCTTATCTACTAATGGAGGG + Intronic
966667595 3:182489330-182489352 CTCTGTGACCTACTTGGGGATGG - Intergenic
966750822 3:183320464-183320486 CTCTGTAACATACAAGTGCAAGG - Intronic
967047201 3:185748468-185748490 CTATGTAACCTATTACTGGAGGG - Intronic
971021572 4:22541972-22541994 TTTTGTATCCTACTAATGGCGGG - Intergenic
971733693 4:30418097-30418119 GTCTGCAAACTAGTAATGGATGG + Intergenic
971931436 4:33089289-33089311 CTTTATACTCTACTAATGGAAGG - Intergenic
975785918 4:77888197-77888219 CTCTGTTACCTTCTAAAGGCAGG - Intronic
975937417 4:79598908-79598930 CTCTGTCTCCTTCTAAAGGAAGG + Intergenic
982462138 4:155684008-155684030 CTCTGTCATCTGCAAATGGAAGG + Intronic
986447740 5:7837465-7837487 CTCTGTATCCTCCTGTTGGAGGG - Intronic
991061575 5:62381907-62381929 CTCTGTACCTTACTCATGAAGGG + Intronic
992612463 5:78519348-78519370 CTCTGTACCCTACAAGTGGGTGG + Intronic
992721263 5:79563691-79563713 CTCTGCAATCTCCTAATGAATGG + Intergenic
995466868 5:112459557-112459579 CCCTGATACCTACTAATGAATGG + Intergenic
996102004 5:119453506-119453528 CTCTGTAACCTCCAAGTGCAGGG + Intronic
997238750 5:132292059-132292081 CTCTGTAACCAACTGATGGAGGG + Intronic
1002336608 5:178483722-178483744 CCCCGTAACCTAATACTGGAGGG - Intronic
1007089141 6:39171153-39171175 CTCCGTAACCTACTAATCAAAGG - Intergenic
1012773527 6:103473716-103473738 CTTTTTAACCTCCTAATTGATGG - Intergenic
1012952341 6:105531807-105531829 CTCTGCTACCTACTAATTGGAGG - Intergenic
1017373171 6:153736437-153736459 CTCTGTAGCCTATTCATGGAGGG + Intergenic
1017956746 6:159184904-159184926 CTCTGTTGCCTGCCAATGGAAGG + Intronic
1018308411 6:162482787-162482809 CTGTGTGGCTTACTAATGGAAGG + Intronic
1021617122 7:22513538-22513560 CTCAGCAAACTAATAATGGAAGG - Intronic
1021993532 7:26158628-26158650 CTCTGTAACCTACTAATGGAGGG - Intronic
1022926716 7:35062990-35063012 CTCAGCAAACTAATAATGGAAGG - Intergenic
1024032390 7:45473178-45473200 ATCTATAAATTACTAATGGAAGG - Intergenic
1027973564 7:85119491-85119513 ATCCTTAACCTACTAATGGAGGG + Intronic
1028375554 7:90142561-90142583 CTCAGCAAACTAATAATGGAAGG + Intergenic
1037078360 8:14751366-14751388 CTCTAGATCCTACTAATGAATGG - Intronic
1044158066 8:88875287-88875309 TTCTGTAACAGAGTAATGGATGG - Intergenic
1045823358 8:106368051-106368073 ACCTGTAACCTAGTAAGGGAGGG - Intronic
1053109178 9:35442247-35442269 ATCTGTAACCTCATATTGGATGG - Intergenic
1053819014 9:41946156-41946178 GTCTGTAACTTACTCATAGAGGG - Intronic
1055831516 9:80384771-80384793 CTCTGTCACTTACTACTGGTGGG - Intergenic
1058191284 9:101919239-101919261 CTCTGCAAGCAGCTAATGGAGGG - Intergenic
1058382135 9:104389016-104389038 CTCTGTGAGCTCCCAATGGAAGG - Intergenic
1058554760 9:106155183-106155205 CTCTGTAAACTCCTAAAGCAAGG - Intergenic
1059538897 9:115111333-115111355 CTGTGTAACCTAATCATGGAAGG - Intronic
1189183176 X:39023584-39023606 CTCAGTAACTTACAAATAGAAGG - Intergenic
1200168134 X:154051387-154051409 CTCTGTCGCCACCTAATGGATGG + Intronic