ID: 1021996914

View in Genome Browser
Species Human (GRCh38)
Location 7:26187875-26187897
Sequence CAGCATGTTAAGATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021996914_1021996919 29 Left 1021996914 7:26187875-26187897 CCTGCCTCCATCTTAACATGCTG No data
Right 1021996919 7:26187927-26187949 TTCTGACAGTCCAGTTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021996914 Original CRISPR CAGCATGTTAAGATGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr