ID: 1021996919

View in Genome Browser
Species Human (GRCh38)
Location 7:26187927-26187949
Sequence TTCTGACAGTCCAGTTTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021996913_1021996919 30 Left 1021996913 7:26187874-26187896 CCCTGCCTCCATCTTAACATGCT No data
Right 1021996919 7:26187927-26187949 TTCTGACAGTCCAGTTTTAGAGG No data
1021996914_1021996919 29 Left 1021996914 7:26187875-26187897 CCTGCCTCCATCTTAACATGCTG No data
Right 1021996919 7:26187927-26187949 TTCTGACAGTCCAGTTTTAGAGG No data
1021996917_1021996919 22 Left 1021996917 7:26187882-26187904 CCATCTTAACATGCTGGATTCAA No data
Right 1021996919 7:26187927-26187949 TTCTGACAGTCCAGTTTTAGAGG No data
1021996916_1021996919 25 Left 1021996916 7:26187879-26187901 CCTCCATCTTAACATGCTGGATT No data
Right 1021996919 7:26187927-26187949 TTCTGACAGTCCAGTTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021996919 Original CRISPR TTCTGACAGTCCAGTTTTAG AGG Intergenic
No off target data available for this crispr