ID: 1022001850

View in Genome Browser
Species Human (GRCh38)
Location 7:26233494-26233516
Sequence AAGAAGAAGAAGAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022001846_1022001850 27 Left 1022001846 7:26233444-26233466 CCAGCCTGGGCGACAGAGCGAGA 0: 26768
1: 89687
2: 191248
3: 194442
4: 151704
Right 1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1022001848_1022001850 2 Left 1022001848 7:26233469-26233491 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1022001847_1022001850 23 Left 1022001847 7:26233448-26233470 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022001850 Original CRISPR AAGAAGAAGAAGAAGAAGGC TGG Intergenic
Too many off-targets to display for this crispr