ID: 1022009556

View in Genome Browser
Species Human (GRCh38)
Location 7:26297024-26297046
Sequence TTTGACATTTAATCTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 1, 2: 3, 3: 68, 4: 626}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022009556_1022009558 21 Left 1022009556 7:26297024-26297046 CCATTTAAAGATTAAATGTCAAA 0: 1
1: 1
2: 3
3: 68
4: 626
Right 1022009558 7:26297068-26297090 ATATATGTAAATATAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022009556 Original CRISPR TTTGACATTTAATCTTTAAA TGG (reversed) Intronic
900851142 1:5144019-5144041 TTTGAAAATAAATTTTTAAATGG - Intergenic
903314560 1:22491660-22491682 TTGGACATTTATTCCCTAAAGGG + Intronic
904323253 1:29710302-29710324 TTTTTCATTTGATCTTGAAAAGG + Intergenic
906008149 1:42496751-42496773 TTGGTCATTTAACTTTTAAAAGG + Intronic
906887341 1:49664235-49664257 TCTGACATTTCATCTTAAAGAGG - Intronic
907635308 1:56128584-56128606 CTGGACATTTAATTTCTAAAAGG + Intergenic
908591452 1:65640357-65640379 TTTCACTTTTCATCTTTCAAGGG + Exonic
908726629 1:67183623-67183645 TATTATTTTTAATCTTTAAATGG + Intronic
908951048 1:69563369-69563391 TTTGACTTTCAATCTTCATATGG - Intergenic
909215775 1:72886516-72886538 TTTTATATTTAATCTCAAAAGGG - Intergenic
909408600 1:75321999-75322021 TTTAAAAATTGATCTTTAAAAGG + Intronic
909550134 1:76889413-76889435 CTTGAAATATAATTTTTAAAAGG + Intronic
909995539 1:82274493-82274515 TTTATGATTTAATCTTTTAAAGG - Intergenic
910142325 1:84039293-84039315 TTTTACATTTACTCAGTAAATGG - Intergenic
910166570 1:84334480-84334502 TATGTCATTTATTCTTTCAAAGG + Intronic
910214252 1:84827001-84827023 TTTCCCAATTAATCTTTTAATGG + Intronic
910388369 1:86709309-86709331 TGTGAAGTTTAATCTTTGAAGGG + Intronic
910489314 1:87751203-87751225 TTCTACATGTTATCTTTAAAGGG + Intergenic
910552553 1:88492911-88492933 TTTAACATTTTTTATTTAAATGG - Intergenic
911234911 1:95401988-95402010 TTAGACATTTACATTTTAAATGG - Intergenic
911365258 1:96930137-96930159 TTTGACCTATGATCATTAAAAGG + Intergenic
911418201 1:97603582-97603604 TTTGATATTACATTTTTAAAGGG - Intronic
911658952 1:100478046-100478068 TTTTATATTTAAACTTTTAAAGG + Intronic
911734602 1:101323289-101323311 TTTGGCAATTAATCTTGTAACGG + Intergenic
911786836 1:101961268-101961290 TGTTACATTTAATTTGTAAATGG + Intronic
911980912 1:104564766-104564788 TTTGTCGTTTAATTTCTAAAGGG + Intergenic
912305733 1:108564634-108564656 TTTCACTAATAATCTTTAAAAGG - Intronic
913406022 1:118491317-118491339 TTTGACACTGCTTCTTTAAAAGG - Intergenic
913572541 1:120135385-120135407 TTTTACATTTAAGTTTTTAAAGG + Intergenic
913717114 1:121547420-121547442 CTTGACATTTAGTCTTACAATGG - Intergenic
914293381 1:146296299-146296321 TTTTACATTTAAGTTTTTAAAGG + Intergenic
914554425 1:148747082-148747104 TTTTACATTTAAGTTTTTAAAGG + Intergenic
914688178 1:150001135-150001157 TATAACATTTAATATTTTAAAGG + Intronic
915608456 1:156970514-156970536 TGTCACATTTAATCTTTCAATGG + Intronic
916782328 1:168048394-168048416 TTCCAAATTTAATTTTTAAAAGG + Intronic
917130338 1:171735826-171735848 ATTGACATTTATTCTCTGAATGG + Intronic
918312377 1:183293909-183293931 GTTGACATTTTCTATTTAAATGG - Intronic
918328021 1:183428645-183428667 TTTGACTTTAAATCATTCAATGG + Intergenic
918494281 1:185116064-185116086 TTTTACCTTTTATCTTCAAAAGG + Intergenic
918850924 1:189689193-189689215 TTTGATACTTTATCTTTAATTGG - Intergenic
919064621 1:192678039-192678061 TTTGAAATTTATACTTTAAAAGG + Intergenic
919259768 1:195177291-195177313 TTTGAAATCAAATATTTAAAAGG + Intergenic
919431721 1:197502198-197502220 ATTTACAATTAATGTTTAAATGG + Intergenic
920070422 1:203298776-203298798 TTTGAGATTTATTCTTTATCAGG + Intergenic
921059646 1:211573904-211573926 TTTGACAGTTACTTTTTAAAGGG - Exonic
922595851 1:226812394-226812416 TTTGACATCTTAAATTTAAATGG - Intergenic
923760276 1:236836130-236836152 TTTTACATTTGTTCTTCAAAAGG + Intronic
924063706 1:240203011-240203033 GGTGACCTTTAATCATTAAAAGG - Intronic
924787457 1:247211307-247211329 TGTTACTTTTAATGTTTAAAAGG - Intergenic
1064585501 10:16835823-16835845 TCTGAAATATAAACTTTAAATGG + Intronic
1064727535 10:18296654-18296676 TTTGAACTTTGATTTTTAAAAGG - Intronic
1065151086 10:22824200-22824222 TTTTACATATTATTTTTAAATGG + Intergenic
1065257858 10:23892246-23892268 TCTGACATATAATATTTAAAAGG - Intronic
1065632917 10:27699252-27699274 TTTGACATGAAATATTTAATAGG + Intronic
1065798246 10:29327096-29327118 TTTGGTATTTAATCTTCAACAGG + Intergenic
1065891392 10:30124118-30124140 TTTGACATTAAATCTTTTTTGGG + Intergenic
1065917161 10:30363397-30363419 TGGGACATTTAAACTTTAAAAGG + Intronic
1066040213 10:31541692-31541714 TTTCTCATTTAATCTTCAAAAGG - Intergenic
1066137197 10:32461109-32461131 TTTAACATTAGATATTTAAATGG + Intronic
1066483452 10:35820934-35820956 TTTGTCATTTAATATTTAGGTGG - Intergenic
1067721972 10:48734667-48734689 TTTAACATTTAGTCTGCAAAAGG + Intronic
1067985743 10:51141964-51141986 TTTTATATTTTATCTTTTAATGG + Intronic
1068281822 10:54881896-54881918 TATAATATTTAAACTTTAAATGG - Intronic
1068547225 10:58361117-58361139 TTTTCCATTTAATCTTTTCAAGG + Intronic
1068742389 10:60488442-60488464 ATTGAAATTTACACTTTAAATGG - Intronic
1069125382 10:64625447-64625469 ATTTACATTTACTTTTTAAATGG - Intergenic
1069968815 10:72146795-72146817 TTTCACATTCAATCATTTAAGGG + Intronic
1070224354 10:74485076-74485098 CTTGCCTTTTAATCTTTTAAAGG - Intronic
1071236861 10:83658900-83658922 TATGACATTTAATTATTGAAGGG - Intergenic
1071447670 10:85763952-85763974 TCTATTATTTAATCTTTAAATGG - Intronic
1071932929 10:90494344-90494366 CTTAACACTTAATTTTTAAAAGG + Intergenic
1072624121 10:97099931-97099953 TAAGACATTTAATTATTAAATGG - Intronic
1073089210 10:100919445-100919467 CTTGAAATTTAATATTAAAAAGG - Intronic
1073850675 10:107613967-107613989 ATTTACATTTAATCTTTTATTGG + Intergenic
1073871403 10:107868990-107869012 TTTGGCATTTATACTTTTAATGG - Intergenic
1074168893 10:110913114-110913136 TTTCACATTTATACTTTAAATGG + Intronic
1074482861 10:113842168-113842190 TGAAACATTTAATCTTTGAAAGG - Intronic
1074498427 10:114000546-114000568 TCTGAAATTTAGTCTTTAATTGG + Intergenic
1074512214 10:114124797-114124819 TTTGACATTACATATTTTAAAGG + Exonic
1074766997 10:116706882-116706904 TCTGACCCTGAATCTTTAAAGGG + Intronic
1076443108 10:130493803-130493825 TTTAAAATTTAATCCTCAAACGG + Intergenic
1076578579 10:131491081-131491103 TTCCAAATTTAATATTTAAATGG - Intergenic
1076588011 10:131562781-131562803 TTTCAGAGTTAAACTTTAAATGG - Intergenic
1078006653 11:7537294-7537316 TTTCTCATTTAATCTTCAAGGGG - Intronic
1078092410 11:8273327-8273349 TTTAAAATTCAATCTTTATAAGG - Intergenic
1078262928 11:9728031-9728053 TATCACATTTAATCTTTCACAGG + Exonic
1079255359 11:18823297-18823319 TTTGTCATGAAATCTTTGAAAGG + Intergenic
1079583499 11:22095868-22095890 TCTGGAATTTAATTTTTAAAGGG + Intergenic
1079904785 11:26231997-26232019 TTTGACATGCCATCTTGAAAGGG - Intergenic
1080014873 11:27493499-27493521 TTTGAATTTTAAATTTTAAAGGG - Intergenic
1080401336 11:31939056-31939078 TTTCTCCTTTAATCTGTAAATGG + Intronic
1080927776 11:36776158-36776180 GTTGACATTTATTGTTGAAAGGG - Intergenic
1080975203 11:37331396-37331418 TTTGACATTTAACTTTGAAAAGG + Intergenic
1081480296 11:43480231-43480253 TATGCCATTTACTTTTTAAATGG + Intronic
1081481381 11:43492748-43492770 TTTGCCATTTTCTCTGTAAATGG - Intronic
1082184901 11:49167218-49167240 TTTGACATTTACTCTGTGCAAGG + Intronic
1085851627 11:80127061-80127083 TTAGACATTTATTGTGTAAATGG - Intergenic
1086100885 11:83098561-83098583 CTTGACATTTATTCATTAAGAGG + Intergenic
1086263592 11:84971018-84971040 TCTGACAGTTAATCCCTAAAAGG - Intronic
1086316044 11:85593533-85593555 TTTCACCATTAATCTTTAAATGG + Intronic
1086318832 11:85623104-85623126 TTTGACATTATAGCTTTCAAAGG - Intronic
1086488860 11:87338426-87338448 ATTGACATTTAATCTGCAACTGG - Intergenic
1086681439 11:89678129-89678151 TTTGACATTTACTCTGTGCAAGG - Intergenic
1086684915 11:89721352-89721374 TTTCACATTTATTTTATAAATGG - Intergenic
1087414626 11:97838184-97838206 TTTGAAATTTTTTTTTTAAAAGG - Intergenic
1087907870 11:103720454-103720476 TGTGAGATTTATCCTTTAAAGGG - Intergenic
1088104551 11:106191645-106191667 TTGCTCATTTACTCTTTAAATGG - Intergenic
1088343711 11:108798625-108798647 TTTGATATTCAACCTTAAAAAGG - Intronic
1088694999 11:112359021-112359043 TTTGAGATTTATTCTTTACCTGG - Intergenic
1089702090 11:120251350-120251372 TCTGTCATTTAATCATAAAAAGG - Intronic
1092642406 12:10529250-10529272 TTTGACTTTGATGCTTTAAAAGG - Intergenic
1093050800 12:14502620-14502642 TTTTATATTTAATTTTAAAATGG - Intronic
1093232275 12:16560946-16560968 TTTGACATTTAGTTACTAAAAGG + Intronic
1093243285 12:16704560-16704582 TTTTAAATTTAATTTTAAAAGGG + Intergenic
1093944794 12:25095709-25095731 ATTGGCATTAATTCTTTAAATGG + Intronic
1094297321 12:28922439-28922461 TGTGACATTTATGCTTTAAGGGG - Intergenic
1094463300 12:30722094-30722116 CTTGATAGTTAATCTTAAAATGG + Intronic
1094732100 12:33188825-33188847 TTTTAAATTTAATTTTTAAAAGG + Intergenic
1095284407 12:40390910-40390932 TGTGATATTTAATCATTAAAGGG + Intergenic
1095787511 12:46126161-46126183 TTTGACTGTTGTTCTTTAAAAGG + Intergenic
1095913405 12:47451669-47451691 ATTGACATTTTATCTTGAATTGG - Intergenic
1097641000 12:62182055-62182077 TTTGACATCTAAGCCCTAAAAGG + Intronic
1097746341 12:63307789-63307811 TTTGAAATTTTAGCTTTTAAGGG - Intergenic
1097990730 12:65829660-65829682 TTTGAAATTTAATACTAAAAAGG + Intronic
1098081907 12:66795794-66795816 TTTGACATATAATCTTTCCTTGG + Intronic
1098155967 12:67598819-67598841 CTTGACTTTAAATCTTTCAAAGG - Intergenic
1098562257 12:71887927-71887949 TTTGACAAATAATTTTTGAAAGG + Intronic
1098957840 12:76705784-76705806 TTTTATATTTATACTTTAAAAGG - Intergenic
1098970745 12:76853634-76853656 TTTGACATTTAATTTATGTAAGG - Exonic
1099085093 12:78235993-78236015 TTTCACATTTCATCTTTACATGG - Intergenic
1099198441 12:79647675-79647697 TTAGATTTTTAATCTGTAAAAGG - Intronic
1099493925 12:83321184-83321206 TTTGTCTTTTGACCTTTAAAAGG + Intergenic
1099868588 12:88317324-88317346 TTTCTCATTTAATCTGTTAAAGG + Intergenic
1100778469 12:97998073-97998095 TTTGACATTTATTATTTTAGTGG + Intergenic
1100860873 12:98805423-98805445 TTTGACATTAGAATTTTAAATGG + Intronic
1101564921 12:105896059-105896081 TTTGACTTCTAATCTATAACAGG + Intergenic
1101604325 12:106236531-106236553 ATTGACATGTATGCTTTAAATGG - Intergenic
1101991641 12:109490252-109490274 TTTGACATTTAAACTCTGGAAGG + Intronic
1102089873 12:110177036-110177058 TTACACATTTATTCTTTAAAAGG + Intronic
1102425696 12:112842823-112842845 TTTCACATTTAATCTTCCCAAGG + Intronic
1104153767 12:126110473-126110495 TTTGGCACTTAATTTATAAAGGG - Intergenic
1106059656 13:26276214-26276236 TTTGTCTTTTGATTTTTAAATGG + Intronic
1106147944 13:27068061-27068083 ATTAAAATTTAATCTTTGAAGGG + Exonic
1106194333 13:27480435-27480457 GTTGAAATTTAATCCTCAAAGGG + Intergenic
1106508929 13:30396296-30396318 TTTTAAATTTAAAATTTAAATGG + Intergenic
1106573466 13:30951854-30951876 TTTGAAATTGAATCTAAAAAAGG + Intronic
1106937654 13:34740537-34740559 TTACATATTTAATCTTCAAATGG - Intergenic
1106964746 13:35048903-35048925 TTTGACTTTTAAACTGTAATTGG - Intronic
1107221065 13:37981035-37981057 TTTCTAATTTAATCTTTGAATGG - Intergenic
1107509269 13:41066256-41066278 TTTACCATTTTATATTTAAATGG + Intronic
1107716625 13:43205974-43205996 TTTGAGGTTTAATCCTGAAATGG - Intergenic
1108981968 13:56525254-56525276 TTATACATTTTATCTTTAAAGGG - Intergenic
1109299021 13:60571264-60571286 TTTGACATACTATCTTTGAATGG + Intronic
1109396808 13:61769424-61769446 CTTTACATTTAATTTTTAAGAGG - Intergenic
1109596917 13:64568642-64568664 TATGAGATTTACACTTTAAAGGG + Intergenic
1109653602 13:65361197-65361219 TTCTACTTTTAATCTTTCAAGGG - Intergenic
1109879014 13:68446638-68446660 ATTAACATTTAATATTTTAATGG + Intergenic
1110293844 13:73839444-73839466 TTTTACATTTAAACATTAATAGG - Intronic
1111216197 13:85144933-85144955 TTTCACATTTGATCTTTGAGTGG - Intergenic
1111777289 13:92680753-92680775 TTGTACATTCCATCTTTAAAAGG + Intronic
1111847254 13:93526678-93526700 GATGACATTCAATCTTTGAAGGG - Intronic
1112440352 13:99420541-99420563 TTTTACATTTAATCATTGACAGG + Intergenic
1112803487 13:103137300-103137322 TTTGACATGAAATCTATACAAGG - Intergenic
1112854834 13:103755534-103755556 TTTGACAAAAAATATTTAAAAGG + Intergenic
1112868363 13:103937056-103937078 AAAGACATTTAATCATTAAAAGG + Intergenic
1112990111 13:105503086-105503108 TTTGATTTTTAAAATTTAAAAGG + Intergenic
1113230452 13:108208019-108208041 GTTTACATTTCATATTTAAATGG + Exonic
1113531523 13:111030920-111030942 TCTGAGGTTTAATGTTTAAAGGG + Intergenic
1113704427 13:112417548-112417570 TTTGTCATTCAATTTCTAAAAGG + Intronic
1114064324 14:19048248-19048270 TTTTAAATATAATCTTTAAAAGG + Intergenic
1114097935 14:19351750-19351772 TTTTAAATATAATCTTTAAAAGG - Intergenic
1114144052 14:19952275-19952297 TTTCACATTTCTCCTTTAAATGG + Intergenic
1115005035 14:28471765-28471787 TTTGTCATTTATTGTTTAAAAGG + Intergenic
1115733586 14:36298745-36298767 TTTGATATTGATACTTTAAAAGG - Exonic
1116233635 14:42249894-42249916 GTTGACATTAAGTCTTTAAGGGG - Intergenic
1116241998 14:42355918-42355940 TTAAACATTTAATATTTGAAAGG + Intergenic
1116302261 14:43198694-43198716 TGTGACATGAAATTTTTAAACGG - Intergenic
1116724552 14:48545902-48545924 TGTGCCATGTAATCTATAAAGGG + Intergenic
1117923548 14:60751200-60751222 TTTGAAATTTAATTTCTGAATGG - Intronic
1118070579 14:62242950-62242972 TTGGACCTTTGATCTTTACAAGG - Intergenic
1118193406 14:63602065-63602087 TCTGTCTTTTCATCTTTAAAAGG + Intronic
1119062058 14:71485167-71485189 CCTGTCATTTTATCTTTAAAAGG - Intronic
1119197800 14:72730426-72730448 TTTGACAATTCATCTTAACACGG + Intronic
1120265800 14:82249155-82249177 TTTTTCATTGAATCTTTACAAGG + Intergenic
1120506914 14:85364349-85364371 TTTTAGAATTAATATTTAAAGGG - Intergenic
1121129193 14:91429818-91429840 CTTAACATTTAATCATAAAAAGG - Intergenic
1121311895 14:92939757-92939779 ATTGAAATTTTATTTTTAAAAGG + Exonic
1122189002 14:100025121-100025143 TTTGACTTCTTATCTTAAAAAGG - Intronic
1122320050 14:100849914-100849936 TTTTTCATTTATTCTTTGAAAGG - Intergenic
1122460998 14:101895253-101895275 TTTGAATTGTACTCTTTAAATGG - Intronic
1123197865 14:106633847-106633869 TTTGACATTTACTTTTGCAACGG - Intergenic
1123492289 15:20790919-20790941 TTTTAAATATAATCTTTAAAAGG - Intergenic
1123548791 15:21360006-21360028 TTTTAAATATAATCTTTAAAAGG - Intergenic
1125427104 15:39559887-39559909 TTTGTCATTTAATTTTTATCTGG + Intergenic
1126257683 15:46647015-46647037 TTTAACATTTGAGATTTAAAAGG - Intergenic
1126391166 15:48154268-48154290 TTTGATAATTACTTTTTAAATGG + Intronic
1126600939 15:50426808-50426830 TTTGACATTTTTCCTTTCAAAGG - Intronic
1126838702 15:52694827-52694849 TTTTAAATTTAAATTTTAAAAGG - Intronic
1127027881 15:54828210-54828232 TTTGACATTTTATATGTCAAAGG + Intergenic
1127532221 15:59854669-59854691 TTAGAGACTGAATCTTTAAAAGG + Intergenic
1128824596 15:70701107-70701129 TCTGAAATTTAATATTTTAATGG + Intronic
1129015072 15:72460230-72460252 TTGAACAGTTGATCTTTAAAAGG + Intergenic
1129490172 15:75917057-75917079 TTTGCCATTTAACTTTCAAATGG - Intronic
1131201289 15:90398194-90398216 TTTCACATTAAATCTGCAAAAGG + Intronic
1131763370 15:95649045-95649067 ATTGGCATTTGATTTTTAAAAGG - Intergenic
1131780107 15:95846795-95846817 TTTGACTTTTAATCTGTGAGTGG + Intergenic
1202957127 15_KI270727v1_random:87240-87262 TTTTAAATATAATCTTTAAAAGG - Intergenic
1133778367 16:8916581-8916603 TTTGAAAGTTGAGCTTTAAATGG - Intronic
1134533325 16:15003054-15003076 TTTTACAGTTATTCTTTATAAGG + Intronic
1134646667 16:15873691-15873713 TAAAACATTTATTCTTTAAAAGG + Intronic
1135388043 16:22061941-22061963 TCTTCCATTTAATCTTTAAGAGG - Intronic
1135570434 16:23545149-23545171 TTTAACTTTTCATCTCTAAAAGG - Intronic
1137072533 16:35916904-35916926 TTTAAAATATAATCTATAAAAGG - Intergenic
1137758595 16:50922194-50922216 TTTGACATTTAATCAGTGGATGG + Intergenic
1138767285 16:59619308-59619330 TCTGACATTAAATCTCAAAATGG - Intergenic
1138775336 16:59715957-59715979 TATTATATTTAATCTTTACAAGG + Intronic
1138956809 16:61980858-61980880 TTAGACATTTTATATTTGAATGG - Intronic
1139862708 16:70037685-70037707 TTTTACAGTTATTCTTTATAAGG - Intergenic
1140220958 16:73043535-73043557 TTTGGCTTTTAACATTTAAAGGG - Intronic
1140411606 16:74744303-74744325 TTTCACATTCATTATTTAAAAGG + Intronic
1140530942 16:75665527-75665549 TGTGAGATTTATGCTTTAAAAGG - Intronic
1140728009 16:77831277-77831299 CTTGACATATAGTCTATAAATGG + Intronic
1141324659 16:83045123-83045145 TATGTCATTTAATCTCTAATAGG - Intronic
1141804585 16:86334413-86334435 TTCAACATGCAATCTTTAAAGGG + Intergenic
1142951762 17:3487737-3487759 TTCAACATTTACTCTTGAAATGG + Intronic
1143261104 17:5598899-5598921 GTTGAAATATAAACTTTAAAGGG + Intronic
1143330931 17:6135182-6135204 TTTGAAATTTTAGCTATAAATGG - Intergenic
1143923313 17:10348195-10348217 CTTGTCATTTAAACTTGAAAGGG + Intronic
1144176506 17:12712817-12712839 TTTGACTTTTAAGATTGAAAAGG - Intronic
1144287363 17:13790237-13790259 GTTGACATTCTATTTTTAAATGG - Intergenic
1144513367 17:15896827-15896849 TTTTACTTTTATTCTTTAAAGGG - Intergenic
1145126777 17:20307477-20307499 TTTCACTTTCATTCTTTAAAGGG - Intronic
1146045229 17:29499950-29499972 TTTAACATTTTATATTCAAAAGG - Intronic
1146953054 17:36920046-36920068 TTTGAGATTTTATCTTACAATGG - Intergenic
1147786961 17:42985664-42985686 TATTACATTTAACCTTAAAACGG - Intronic
1149953898 17:61023312-61023334 TATTACATTTAATATTTATATGG + Intronic
1150111816 17:62507665-62507687 GTTGACATTTAAACTTTTACAGG + Intronic
1150412853 17:64961476-64961498 ATTGCCTTTAAATCTTTAAACGG + Intergenic
1150469697 17:65426411-65426433 TTTGACTTTAAATATTTAAAGGG - Intergenic
1151062445 17:71111639-71111661 TTTGACAGTAAATATTTGAATGG + Intergenic
1152302486 17:79503475-79503497 TTTGACATGTAATCAATACAGGG + Intronic
1152675118 17:81636321-81636343 CTTGACAATTCCTCTTTAAAAGG - Intronic
1153079735 18:1208829-1208851 TGTGAGATTTACGCTTTAAAGGG + Intergenic
1153934600 18:9910119-9910141 TTTAACATTTAATATTAATAAGG + Intergenic
1154449835 18:14465477-14465499 TTTTAAATATAATCTTTAAAAGG - Intergenic
1155534627 18:26804414-26804436 TCTGAATTTTAATATTTAAAAGG + Intergenic
1155602453 18:27565200-27565222 TGTGACATTTCATTTTGAAAAGG - Intergenic
1155670567 18:28366105-28366127 TTTGTCATTTAATTTTTATGTGG - Intergenic
1155755871 18:29495033-29495055 TATGACATATAATCTGTCAATGG + Intergenic
1155964470 18:32022932-32022954 TTTAAAAATTAAGCTTTAAATGG - Intronic
1156176214 18:34549820-34549842 TTTAAAAGTTAGTCTTTAAATGG + Intronic
1156295350 18:35784465-35784487 TTTGAAATGTAATATTGAAATGG - Intergenic
1156906244 18:42355755-42355777 TTTCTCATTTATTCTGTAAATGG + Intergenic
1157012605 18:43669404-43669426 TTTGGCATATAATAGTTAAATGG + Intergenic
1157269638 18:46262437-46262459 TTAGAAATTTAATCTGTGAAAGG + Intronic
1158377879 18:56892752-56892774 CTTGACATTTAATATGCAAAAGG + Intronic
1158849758 18:61483451-61483473 TTTGTCATTTAATCCTTACAAGG - Intronic
1159130228 18:64272832-64272854 ATTGACAATTTATCTTTGAATGG + Intergenic
1159199107 18:65160432-65160454 TTTGACAGTGATTCTTTAATGGG + Intergenic
1159229073 18:65581888-65581910 TATGACATTTATTTTTTAAATGG - Intergenic
1159295206 18:66477199-66477221 TGTGAAATGTAATTTTTAAATGG - Intergenic
1159317118 18:66790035-66790057 TTTGATATTTAAAATTTAACTGG - Intergenic
1159532841 18:69677535-69677557 TTTGACATTATATTTTTAAGTGG - Intronic
1159766119 18:72490285-72490307 TTTATTTTTTAATCTTTAAAAGG - Intergenic
1160170996 18:76554356-76554378 TTTGGCATTTTTTCTTTATATGG + Intergenic
1163185079 19:15632139-15632161 TATGAAACTTAAACTTTAAAGGG - Intronic
1164155168 19:22590922-22590944 TTGGATATTTAATCATTAAATGG - Intergenic
1165560456 19:36675225-36675247 TTTAACATTTAACATTTAATAGG - Intergenic
1166269185 19:41703571-41703593 TTTTGCATTTAAGATTTAAAGGG - Intronic
1168262291 19:55202716-55202738 TTTGACATGTAATCAATATAAGG - Intronic
1168370908 19:55833435-55833457 TTTTAAATTAAATCTTTATAGGG - Intronic
925686018 2:6474538-6474560 TTTGATATGTAATCATAAAATGG - Intergenic
926404071 2:12531654-12531676 TTTGGAATTTAATTTTTAAAAGG - Intergenic
927829317 2:26335070-26335092 ATTGAAATGTACTCTTTAAAAGG - Intronic
928032715 2:27795410-27795432 TTTGAAATTTAAACATAAAAGGG + Intronic
928153790 2:28857446-28857468 GATGACCTTTAAGCTTTAAAGGG + Intronic
928738234 2:34318400-34318422 GTTGAGATTTAATCATTAGATGG + Intergenic
929353333 2:40988144-40988166 TTTTACATGTAATCACTAAACGG + Intergenic
929843223 2:45493389-45493411 TCTGAGATTTAATGCTTAAAGGG + Intronic
930398365 2:50850707-50850729 TTTGATATTGATTTTTTAAAAGG - Intronic
930564123 2:52998190-52998212 TTTTACATTTAGTTTTTCAAGGG - Intergenic
930648781 2:53942956-53942978 TTTGACATTTACTTTGTTAATGG - Intronic
930876107 2:56218825-56218847 TTTGACATTAAATTTTTCTAAGG + Intronic
931023956 2:58086899-58086921 TTTGTAATCTAATCTTAAAAGGG + Intronic
931073424 2:58682066-58682088 TTTGATATTTTATCTTTTATTGG + Intergenic
931181685 2:59907967-59907989 TTTTACATTTTATATTTGAAAGG - Intergenic
931195026 2:60043792-60043814 TATCTCATTTAATCTTTAAATGG - Intergenic
931313762 2:61106707-61106729 AATGACATTTAATCTTTGACAGG + Intronic
932249507 2:70230312-70230334 ATTGACATATAATATTAAAAAGG - Intronic
932638542 2:73416213-73416235 TTTTACATTTTTTCTTTAGAGGG - Intronic
933351847 2:81162931-81162953 GATGACATTTAATATTTGAAAGG - Intergenic
933546168 2:83715309-83715331 TTGAACATTGAATCTGTAAAAGG + Intergenic
934110245 2:88735536-88735558 CTTAACTTTTAATTTTTAAAGGG - Intronic
935040060 2:99417459-99417481 TTGGACACAGAATCTTTAAAGGG + Intronic
935068658 2:99674698-99674720 TGGGAAATTTAATGTTTAAATGG + Intronic
935499208 2:103817981-103818003 TTTGACGTAGAATCTTGAAATGG - Intergenic
935566375 2:104612329-104612351 TTTGAGATAAGATCTTTAAAGGG - Intergenic
936532511 2:113286396-113286418 GCTTACCTTTAATCTTTAAAGGG - Intergenic
936923172 2:117709711-117709733 GTTAACATTTAATCTTGAAATGG + Intergenic
938045345 2:128114050-128114072 TATGACATAGAAACTTTAAAGGG - Intronic
938481595 2:131667274-131667296 TTTTAAATATAATCTTTAAAAGG + Intergenic
938950604 2:136251087-136251109 TGTCACATTTTATCTTAAAAAGG + Intergenic
939042775 2:137211103-137211125 CTTGACATTTAGTGTTTCAAAGG + Intronic
939266994 2:139886696-139886718 TTTGACAGTTACTTTTTTAAAGG - Intergenic
939309224 2:140451984-140452006 CTTGATAGTTAATTTTTAAAGGG - Intronic
939309432 2:140455412-140455434 TTTCCCATTTAATCTGTATATGG + Intronic
939789529 2:146554730-146554752 TTTCACATTTCCTCTGTAAATGG + Intergenic
940003014 2:148985655-148985677 TTAGCCATTTTATCTTTAAAAGG + Intronic
940435040 2:153641433-153641455 TTTGACATTTCATTTGTTAAAGG + Intergenic
940732592 2:157410494-157410516 TTTTATATTAAGTCTTTAAAAGG + Intergenic
940957277 2:159741859-159741881 TTTGGCATATAATCTCTAAATGG - Intronic
941311454 2:163937461-163937483 TCTGACATTTACTCATAAAATGG - Intergenic
941354175 2:164468299-164468321 TTTGACATTGGATCTATAATGGG + Intergenic
941513432 2:166442179-166442201 TTTGACATGTTATTTTAAAAGGG - Intronic
941566855 2:167119318-167119340 TTTGAAATATAATTTTTTAAAGG + Intronic
941679802 2:168385113-168385135 TGTGAGATTTATGCTTTAAAGGG - Intergenic
941799470 2:169641444-169641466 TTTAGCTTTTAATTTTTAAAAGG - Intergenic
942332032 2:174836617-174836639 TTTGACATTTAATCTTGTAGAGG + Intronic
942717659 2:178912317-178912339 TTTCACATTTAAGCTGTCAATGG - Intronic
943290337 2:186063196-186063218 TTTGAGATGTAAACTTTAACAGG - Intergenic
943313999 2:186362963-186362985 TTAGAACTTTAATGTTTAAATGG - Intergenic
943918561 2:193671678-193671700 TTTGACATTTACACATTATATGG - Intergenic
943960674 2:194258741-194258763 TTAAACAGTTAATTTTTAAAAGG + Intergenic
944941586 2:204633826-204633848 TTTTAAACTTAATTTTTAAAAGG + Intronic
945702894 2:213193168-213193190 ATAGACATTTAATTTTTTAATGG + Intergenic
946293453 2:218763947-218763969 TTTTATTTTTAAACTTTAAATGG + Intergenic
947064756 2:226210630-226210652 TTTGTAAATTAATTTTTAAATGG + Intergenic
947161016 2:227214277-227214299 AATGACTTTTAATCTTTAAATGG - Intronic
947195272 2:227558535-227558557 TTTAAAATTTATTTTTTAAAAGG + Intronic
947845782 2:233242551-233242573 GTTGACATTTTGTCTTTATAAGG - Intronic
948457280 2:238110838-238110860 TTTGACATTTTATTTTTAAATGG - Intronic
949073350 2:242039948-242039970 ATTGACTTTTATTCTCTAAAAGG - Intergenic
1169561348 20:6803818-6803840 TTTGAAACTTTGTCTTTAAATGG + Intergenic
1169772207 20:9213622-9213644 TTTTACATGTAATTTTTATATGG + Intronic
1169830381 20:9818632-9818654 TTTAATATTTAATCTCTGAATGG + Intronic
1169958887 20:11136666-11136688 TTTGAAATTTCATCATTAAATGG - Intergenic
1170233854 20:14080118-14080140 CTTGACTTTTAATCTTCAAGAGG + Intronic
1170259290 20:14385501-14385523 TTTGACATGTAGACTTTAAAGGG - Intronic
1170700969 20:18703109-18703131 TTTCAGATTTATTTTTTAAAAGG - Intronic
1171055944 20:21906366-21906388 TTTGACATTCATTCTTTATATGG + Intergenic
1172567972 20:35945864-35945886 TCTTACATTAAATATTTAAAGGG + Intronic
1174364080 20:50045816-50045838 ATTTACATTTATTGTTTAAATGG + Intergenic
1174891093 20:54395179-54395201 TTTTAAATTTTATTTTTAAAAGG + Intergenic
1176446339 21:6824882-6824904 TTTTAAATATAATCTTTAAAAGG + Intergenic
1176824508 21:13689912-13689934 TTTTAAATATAATCTTTAAAAGG + Intergenic
1176874244 21:14112125-14112147 GTTGAAAATTAATTTTTAAATGG + Intronic
1176944698 21:14965245-14965267 TTTAGCATTTCTTCTTTAAATGG - Exonic
1177203910 21:17988999-17989021 TTTGGCATTGAACCTTTACAGGG - Intronic
1177473440 21:21588260-21588282 TTTGATATTTGATATTTGAAAGG + Intergenic
1177704538 21:24685232-24685254 TTCCACATTTATTCTTTTAACGG - Intergenic
1177787663 21:25689623-25689645 TTTGAGTTTTCATCTGTAAATGG - Intronic
1177798880 21:25807808-25807830 ATTGGCATCTAATTTTTAAAGGG - Intergenic
1177888394 21:26774616-26774638 TTTTATAGATAATCTTTAAACGG - Intergenic
1177917916 21:27113990-27114012 TTTACCACTTAATCCTTAAATGG + Intergenic
1178389549 21:32187118-32187140 TTTGACATTTGGTATCTAAAGGG + Intergenic
1178869286 21:36359268-36359290 TGTGACTTTTAATCTTTTGAAGG + Intronic
1179378948 21:40880748-40880770 TATTACATTTTACCTTTAAAAGG - Intergenic
1180482815 22:15770874-15770896 TTTTAAATATAATCTTTAAAAGG + Intergenic
1180859183 22:19067342-19067364 TATGACATTGAAATTTTAAAGGG - Intronic
1181717119 22:24739393-24739415 TTTGATAATCAAACTTTAAAAGG + Intronic
949822520 3:8131556-8131578 TTTGATACTTAATCTTGGAAAGG - Intergenic
950701915 3:14756809-14756831 TTTGGCTTTTATTCTGTAAAAGG + Intronic
951316617 3:21194990-21195012 CTTAACATTTAATATTTACAGGG + Intergenic
951932585 3:27985266-27985288 TTTGACATTTTCTGTATAAATGG - Intergenic
952907360 3:38150483-38150505 TTTCACATTGAATCTTAAAAAGG + Intergenic
952911183 3:38188155-38188177 TTTGAGCTTTAATCTGAAAAGGG - Intronic
953269788 3:41430100-41430122 TAACACATTTATTCTTTAAAAGG + Intronic
953720658 3:45351979-45352001 TTTGACAGTTATTCATCAAATGG + Intergenic
953945084 3:47139442-47139464 TTTGAAATTTAAACTCTATATGG - Intronic
956427163 3:69148134-69148156 TTTCACAGATTATCTTTAAAGGG + Intergenic
956817082 3:72917460-72917482 TTTGACATTTGATATATGAAGGG - Intronic
957270406 3:78023355-78023377 TTTGATATTTTGTCTTAAAAAGG - Intergenic
957324039 3:78669140-78669162 TCTGACATTCAGTTTTTAAAAGG - Intronic
957741638 3:84278423-84278445 TTTTAGATCTAATTTTTAAAGGG - Intergenic
957758835 3:84528237-84528259 TTCTTCATTTCATCTTTAAAAGG - Intergenic
958033511 3:88144075-88144097 TTTAACATTTAATTTTTTGAAGG - Exonic
958131895 3:89437605-89437627 TATGAAATTTTATCTTTAACTGG + Intronic
958860647 3:99441372-99441394 TTGGACATTTAATTCTTAATTGG + Intergenic
958921165 3:100107211-100107233 CTGGACAGTTCATCTTTAAAAGG - Intronic
959077877 3:101769839-101769861 TTTGACTTTTAATTTTAATATGG - Exonic
959082648 3:101818188-101818210 TTTTAAATTTAATTTTTAGAAGG + Intronic
959303199 3:104628719-104628741 TTTGTCATTTAGTCTCAAAATGG - Intergenic
959800659 3:110491211-110491233 CTTCACTTTTAATTTTTAAATGG + Intergenic
959803027 3:110517991-110518013 TTTCACATTTAATCCTTAATTGG - Intergenic
960497360 3:118391390-118391412 TATGATTTTTAATTTTTAAATGG - Intergenic
960568538 3:119161984-119162006 TGTCATATTTATTCTTTAAATGG - Intronic
960814755 3:121661007-121661029 TTAGACACTTAAATTTTAAAAGG + Intergenic
960832835 3:121868239-121868261 TTTTAAAATTAATGTTTAAATGG - Intronic
961144639 3:124584053-124584075 TTTTACATTTTTTTTTTAAATGG + Intronic
961973967 3:131002874-131002896 TTTGACAATTCAGCCTTAAAGGG - Intronic
962365992 3:134782149-134782171 TTTGTCCTTTAATCAGTAAATGG + Intronic
963817253 3:149845345-149845367 GTTGACATTTAGTCTTTTCACGG + Intronic
964214961 3:154269544-154269566 ATTGCCATTAATTCTTTAAATGG - Intergenic
964378371 3:156072106-156072128 TTTGAGATTTAATATTTGGAAGG + Intronic
964573926 3:158143253-158143275 TTTGAGATAAAATCTTTGAAAGG + Intronic
964826761 3:160837069-160837091 CTTAACATTTTTTCTTTAAATGG + Intronic
965027956 3:163327204-163327226 GTTGACATTGACTCCTTAAAAGG - Intergenic
965120898 3:164554952-164554974 TGTGACATCTAATTTTTCAATGG + Intergenic
965303784 3:167038111-167038133 TTTCAAATTTAATCTTGAAATGG - Intergenic
965468250 3:169059205-169059227 TTTCACACTTACTCTTTAAGTGG - Intergenic
965971898 3:174569359-174569381 TATGAAAATTAATCTTTAACTGG - Intronic
966244812 3:177795460-177795482 TTTCATAGTTATTCTTTAAATGG - Intergenic
966764192 3:183445384-183445406 TTTTCCATTTAATCTTTATCTGG + Intergenic
967159981 3:186727205-186727227 TTTCAGATTGAATATTTAAAGGG - Intronic
967464155 3:189782667-189782689 TTTGAACTTTCATCTCTAAAAGG - Intronic
967620275 3:191625095-191625117 TTGGGCATTTAATATTTACAAGG - Intergenic
967921652 3:194618764-194618786 TTTGAGAATTAAACTTAAAATGG - Intronic
968313828 3:197705635-197705657 TTTAACAATTATTCTTTAAAAGG - Intronic
968510767 4:994753-994775 TTTTACTTTTAATTTTTTAAAGG - Intronic
968532387 4:1099640-1099662 TTTCGTATTTAATTTTTAAAAGG + Intronic
968543571 4:1182216-1182238 ATTGACTTTTTTTCTTTAAATGG - Intronic
968580886 4:1394342-1394364 TTTCAAATATAATCTTTAAGGGG - Exonic
969157847 4:5228301-5228323 TTTGCAATTAAATCTTTAATTGG + Intronic
969542753 4:7803761-7803783 CTTGACATTTCAGCTGTAAAAGG + Intronic
970410024 4:15796445-15796467 TTTAATTTTTAATTTTTAAATGG - Intronic
970516960 4:16841869-16841891 TTTGACATTTAATTTGAAAGTGG - Intronic
970561088 4:17282994-17283016 TTTTACTTTTTGTCTTTAAATGG + Intergenic
970574677 4:17415410-17415432 TTTAACATTTAATGTATAATGGG - Intergenic
971196434 4:24474798-24474820 CTTTACATTTAATGTTTATAGGG - Intergenic
971888651 4:32487113-32487135 ATTGAAATCTAACCTTTAAAAGG - Intergenic
972549618 4:40118057-40118079 TTTGAAATATAATTTTTAAAAGG + Intronic
972814756 4:42631739-42631761 ATTGATATTTAATCTTCCAATGG + Intronic
972954439 4:44371582-44371604 TTTTTCATTTAATATTTAATTGG - Intronic
973643063 4:52922222-52922244 TTTGAATTTTATACTTTAAATGG - Intronic
974381778 4:61149909-61149931 TTTGGCATATAATTCTTAAATGG - Intergenic
974746203 4:66080755-66080777 TTTGTCATTTAATTTTTAAAAGG - Intergenic
975406446 4:73996101-73996123 TGTCACATTTTCTCTTTAAAAGG + Exonic
975420875 4:74163318-74163340 TTTTATATTGAATGTTTAAAAGG + Intronic
975717981 4:77224056-77224078 TTTAACAGTTAATCTTTTCATGG - Intronic
976016224 4:80558742-80558764 TTTTAGATATAATCTTTATAAGG - Intronic
976021410 4:80633055-80633077 ATAGAAATTTAATTTTTAAAAGG - Intronic
976053749 4:81038559-81038581 ATTGCCATTTAATATATAAATGG - Intronic
976525255 4:86079876-86079898 TTTGATATTTAAATTTAAAAAGG + Intronic
976955210 4:90888020-90888042 TTTGTCATTTTATTTTTACATGG - Intronic
977256275 4:94743641-94743663 TTTAAAATTTTATCTTTCAAAGG - Intergenic
977788121 4:101064377-101064399 TATCATATTTAATATTTAAAAGG - Intronic
977831885 4:101603919-101603941 TTTGACCCTTAAGCTTTAAAAGG - Intronic
977896422 4:102370504-102370526 TTTGGAATTTAATCTTTCAGGGG + Intronic
977970654 4:103210198-103210220 CTTAACATATAATTTTTAAAAGG + Intergenic
978058321 4:104302498-104302520 TTAGACAATTCATATTTAAAGGG - Intergenic
978105219 4:104893841-104893863 TTTAAAATTTCATCTTTAGAAGG - Intergenic
978456133 4:108894202-108894224 TTTGAAATTTAATTTTACAATGG - Intronic
979057225 4:116012225-116012247 TTTGACTTATAATTTTTAATAGG + Intergenic
979149356 4:117289670-117289692 TTTGACATTTAAAGGATAAATGG - Intergenic
979288885 4:118958108-118958130 TTTAACTTTTCATCTTTCAAGGG + Intronic
979316498 4:119271204-119271226 TTTAACATTTTATCTCTAACAGG + Intronic
980068127 4:128213759-128213781 TTTGACATTTTCTATATAAAAGG + Intronic
980097096 4:128502280-128502302 TTTAACATTTAATATGTATATGG + Intergenic
980106444 4:128592924-128592946 TTTGAACTTTAATGTTTATAAGG - Intergenic
980164042 4:129203014-129203036 TTTGACAATTAATATATTAATGG + Intergenic
980820931 4:138016271-138016293 TTTGAAATTTAAACTTTTATTGG - Intergenic
981108764 4:140911395-140911417 ATAGACATTTAATCTCTAAGTGG - Intronic
981595233 4:146413876-146413898 TTTGACCCTTAATCTGTAATAGG - Intronic
981779421 4:148409748-148409770 TTTGAGATATAATAGTTAAAAGG - Intronic
981873407 4:149513398-149513420 TTTAACATTTACTATTTATAAGG - Intergenic
982285762 4:153732371-153732393 TTTGTTATTTAAACTTTTAAAGG + Intronic
982527950 4:156503647-156503669 TTTGCCTTATAATATTTAAATGG + Intergenic
982655624 4:158145588-158145610 TGTGACATGTAATCTAGAAATGG - Intronic
983221875 4:165051614-165051636 AATTACATTTAATTTTTAAAGGG - Intergenic
983347067 4:166540642-166540664 AATGACATTTATTTTTTAAAGGG + Intergenic
983397953 4:167226601-167226623 TGGGAAATTTAATCTTTAATGGG - Intronic
984117421 4:175699284-175699306 TATGACTTATAATCTTTAAAGGG + Intronic
984133869 4:175911844-175911866 TTTGACATCTAAACTTGAAAGGG - Intronic
984186241 4:176547008-176547030 TCTGACATTCTGTCTTTAAATGG - Intergenic
984843755 4:184092605-184092627 TCTTACATTCACTCTTTAAATGG - Intronic
984896139 4:184541715-184541737 GTTCACATTTTATTTTTAAAGGG + Intergenic
985047511 4:185955122-185955144 TGTGACATTTAACATTTCAATGG + Intronic
986385215 5:7226673-7226695 TTTAAGATTTCATCTTTAAGAGG - Intergenic
986695164 5:10348634-10348656 TTTTATATTTTATGTTTAAATGG + Intergenic
987113249 5:14706641-14706663 TTAGACATTTTGCCTTTAAAAGG + Exonic
987261848 5:16212091-16212113 TGTGAAATTTTATATTTAAAAGG + Intergenic
987766832 5:22243084-22243106 TTCAACAATTAATCTTTGAAAGG - Intronic
987813993 5:22877260-22877282 GTTCACATAAAATCTTTAAATGG + Intergenic
988111069 5:26820788-26820810 GCTGAAATTTAAACTTTAAATGG + Intergenic
988660779 5:33265594-33265616 TTTGAATTTTAATCCTTTAAAGG - Intergenic
989405963 5:41061042-41061064 TTTGTAATTTATTCTTTACAAGG + Intronic
989568192 5:42922253-42922275 TTTAACATTTAATCATTGAAAGG - Intergenic
989574474 5:42977228-42977250 TTTAACATTTAATCACTGAAAGG - Intergenic
989689428 5:44122937-44122959 TATGAGATTTATGCTTTAAAGGG + Intergenic
989701976 5:44278942-44278964 TTAGACATTTATTCCTAAAAAGG - Intergenic
989710480 5:44390420-44390442 CTTCACATTTAATGTTTAAAGGG + Intergenic
989993539 5:50799019-50799041 TTTGTCATTTCATTTTTTAAAGG + Intronic
990257745 5:53988540-53988562 GTTGACATTTAATATTTATAGGG + Intronic
990268895 5:54113502-54113524 TTTAGCACTTAATTTTTAAAAGG - Intronic
990380279 5:55216199-55216221 TTTTAAAAATAATCTTTAAAAGG + Intergenic
991034598 5:62115995-62116017 TTTAAAATTTATTTTTTAAATGG - Intergenic
991339305 5:65589278-65589300 GTTTACATTTAAAATTTAAAAGG + Intergenic
991744287 5:69717335-69717357 GTTCACATTAAATCTTTTAATGG - Intergenic
991753418 5:69837901-69837923 GTTCACATTAAATCTTTTAATGG + Intergenic
991795859 5:70297059-70297081 GTTCACATTAAATCTTTTAATGG - Intergenic
991803035 5:70394628-70394650 GTTCACATTAAATCTTTTAATGG + Intergenic
991823662 5:70592603-70592625 GTTCACATTAAATCTTTTAATGG - Intergenic
991832738 5:70713026-70713048 GTTCACATTAAATCTTTTAATGG + Intergenic
991888230 5:71296578-71296600 GTTCACATTAAATCTTTTAATGG - Intergenic
991940290 5:71844968-71844990 TTTTACAGTTTATCTTTATATGG + Intergenic
992315077 5:75544210-75544232 TTATACATTTCATCTTTTAAAGG + Intronic
992569249 5:78037953-78037975 TGTTACATTTAATGTTTAAAGGG + Intronic
993285908 5:85996194-85996216 TTTGGAATTTAATCTAGAAATGG - Intergenic
993346687 5:86792895-86792917 TTTGGAATTTAGTCTTTCAATGG + Intergenic
993466952 5:88260114-88260136 TTTTACATTTAATATTTACCAGG - Intronic
993495190 5:88600897-88600919 TTTTCCATTTGATTTTTAAAGGG - Intergenic
993514647 5:88815464-88815486 TTTGACTTTTAATTTTAAATTGG - Intronic
993537882 5:89109452-89109474 TTGCACATTTAAAATTTAAAGGG + Intergenic
993797666 5:92287891-92287913 TCTGACATAGAATATTTAAAGGG - Intergenic
994124970 5:96158656-96158678 TTTGACACTTTATTTGTAAAAGG + Intergenic
994806447 5:104453119-104453141 TCTGACAATTAAAATTTAAAAGG - Intergenic
994893572 5:105671071-105671093 TTTGACAATTAATGTTTATTAGG - Intergenic
994931404 5:106190676-106190698 TTTGACATTTGATGTTTAAGAGG - Intergenic
995074213 5:107962082-107962104 TTTTATTTTTAATCTTAAAATGG - Intronic
995107868 5:108395801-108395823 TTAGATATTTGATATTTAAAGGG + Intergenic
995757870 5:115529438-115529460 TTTGACATTTATTCTTGATATGG - Intronic
996134653 5:119825261-119825283 TTTGACATTTATGCCTTCAAAGG - Intergenic
996248584 5:121297605-121297627 TTTGAGATTTAAGCACTAAATGG - Intergenic
997151851 5:131504966-131504988 TTTGAATTTTGCTCTTTAAAAGG + Intronic
997971079 5:138402618-138402640 TGTGACAGTTAATCTTTCATGGG - Intronic
998807385 5:145932052-145932074 TTTGTGATTTAATTTTTAATTGG + Intergenic
999022214 5:148179254-148179276 TTTAACAGATAATATTTAAATGG - Intergenic
999576273 5:152981416-152981438 TCTGTCACTTAATATTTAAATGG + Intergenic
999598924 5:153238653-153238675 TTTGTAATTTAATCTTCATAAGG - Intergenic
999791925 5:154948300-154948322 TTTGATATTTAAACTTCCAATGG + Intronic
999921187 5:156322849-156322871 TTTGACCTCAAATCTTTAAATGG - Intronic
1000131251 5:158302160-158302182 TTTGCCATTCAATATTTAATTGG - Intergenic
1000725446 5:164763954-164763976 TCTTACATTTATTTTTTAAAGGG + Intergenic
1001440962 5:171742563-171742585 TTTCTTATTTAATCTTTACAGGG + Intergenic
1001835486 5:174827714-174827736 TTTGAAATGTTATTTTTAAAGGG - Intergenic
1001875959 5:175200886-175200908 TTTGACTTTTAAGGCTTAAATGG + Intergenic
1001998030 5:176177647-176177669 TGTGACATGTCATGTTTAAATGG - Intergenic
1002390991 5:178911540-178911562 TTTCACATATACTCATTAAATGG - Intronic
1004067792 6:12266261-12266283 TTTGACACATATTCCTTAAAAGG - Intergenic
1004157881 6:13186554-13186576 TTTGACATCAAAGCCTTAAAGGG - Intronic
1004967640 6:20873087-20873109 TTTGAACTTGAATTTTTAAACGG - Intronic
1005401122 6:25435721-25435743 TTTGATATTTAATATTTAAGAGG - Intronic
1007536476 6:42595354-42595376 TTTCAGATTTTATTTTTAAATGG + Intronic
1008058357 6:46969825-46969847 TTTGAAATTTGATGTTAAAATGG - Intergenic
1008306733 6:49911731-49911753 TTTAATATTTAATCTCTCAATGG + Intergenic
1009041789 6:58189024-58189046 TTTGACATATAATTTTTATGGGG + Intergenic
1009576452 6:65468124-65468146 TATGACACTTTATCCTTAAAGGG + Intronic
1009836256 6:69005183-69005205 TTTTACCTTTCATTTTTAAAAGG + Intronic
1010241709 6:73622099-73622121 TTTGCTATTTAATATTTCAAAGG - Intronic
1010398470 6:75420388-75420410 TTTGAGTTTTAAACTTTGAATGG + Intronic
1010691880 6:78920722-78920744 TTTGTCATGAAATCTTTAACAGG - Intronic
1010716758 6:79239121-79239143 ATTGACATTTAGCCTTGAAAGGG - Intergenic
1011119789 6:83939275-83939297 CTTGAAATGTAATCTTAAAAAGG - Intronic
1011191382 6:84732736-84732758 TGTGAAATTTATCCTTTAAATGG - Exonic
1011873658 6:91928294-91928316 TTTTACAGTTATTCTTCAAAGGG + Intergenic
1012150503 6:95744566-95744588 TTTCTCATTTAGCCTTTAAATGG - Intergenic
1012276841 6:97284286-97284308 TATGAAATTTAGTCATTAAAAGG + Intergenic
1012342945 6:98151389-98151411 TTTTACTTTTAAAATTTAAAAGG - Intergenic
1012344080 6:98166275-98166297 TTGAACATTTAATATTTAGATGG - Intergenic
1012427825 6:99133623-99133645 TTGGAAATGTAATTTTTAAAAGG + Intergenic
1012542452 6:100377365-100377387 TCTTCCATTTAATCTTTACATGG + Intergenic
1012663453 6:101934581-101934603 TTTTACATTTTATCTCTCAATGG - Intronic
1012743802 6:103056316-103056338 TTTGTCATTAAATCTTTACCAGG + Intergenic
1014048330 6:116921277-116921299 TTTATCATGTAATATTTAAAAGG - Intronic
1014048402 6:116922185-116922207 TTTAGCATTTACTCTTTACAAGG - Intronic
1014176252 6:118334844-118334866 ATAGACATCTAATCATTAAAAGG + Intergenic
1014408030 6:121075861-121075883 TTTGACATGTATGCTTAAAATGG - Intergenic
1014824950 6:126039100-126039122 TTTTACAATTAATCTACAAAGGG + Exonic
1015009029 6:128321231-128321253 CTTGAGATTTAAACTTTTAAAGG - Intronic
1018019831 6:159751231-159751253 TTAGACATTTATTTATTAAAAGG + Intronic
1018611312 6:165650248-165650270 TCTGAAATTTAATTTTTGAATGG + Intronic
1019065542 6:169293082-169293104 TTTGACATTTAAACTTTAAAAGG + Intergenic
1019210699 6:170402166-170402188 TTTAATATTTAATATTTAAGAGG - Intronic
1020331479 7:7021677-7021699 GTTGATATTTATTTTTTAAATGG - Intergenic
1020596156 7:10210504-10210526 TTTGAGAATTTATTTTTAAATGG + Intergenic
1020902379 7:14020998-14021020 TTTGTAATCTAATCTTGAAAGGG + Intergenic
1021223164 7:17997616-17997638 TTTGGCATTTAATATTTTCATGG - Intergenic
1021270706 7:18581583-18581605 TTTTACATTTTGTCTTTATAGGG + Intronic
1021271136 7:18587880-18587902 TTTGAACTTTAATCTTTCATAGG - Intronic
1021278967 7:18693206-18693228 TTTGACACCTAATTGTTAAAAGG + Intronic
1022009556 7:26297024-26297046 TTTGACATTTAATCTTTAAATGG - Intronic
1022380786 7:29857754-29857776 TATGTGATTTAATTTTTAAATGG + Intronic
1022849392 7:34244703-34244725 TCTGGCAATTAATCTTAAAATGG + Intergenic
1022865110 7:34409745-34409767 TTTCACTTATAATCTTTTAAAGG + Intergenic
1023004995 7:35854767-35854789 TTTAACTTTTAATATTTAAAGGG - Intronic
1023239259 7:38125934-38125956 GTTTATATTTAATCTTTGAAGGG + Intergenic
1024255272 7:47536158-47536180 TTTGACCACTAAACTTTAAAAGG + Intronic
1024365293 7:48513383-48513405 TTTGTTATTTAAACTATAAAAGG + Intronic
1024370697 7:48580557-48580579 TTTTACATTATATATTTAAAAGG + Intronic
1024611803 7:51071853-51071875 TTTGACCTCAAATCATTAAATGG - Intronic
1024750559 7:52460334-52460356 TGTGACATTTCATCTTAACAAGG + Intergenic
1025940078 7:66069712-66069734 TCTGACAGTTAAACTTTTAATGG + Intergenic
1026047498 7:66917104-66917126 TTAGACAGTTAATTTTTAAATGG - Intergenic
1026364296 7:69632237-69632259 GTGGACATTTTATCTTTATAAGG + Intronic
1027409770 7:77904070-77904092 TTTGTCATTTAATAGGTAAATGG - Intronic
1027537589 7:79424683-79424705 TTTGAAACTTATTTTTTAAATGG - Intronic
1027818467 7:83010800-83010822 TTAGAGATTTATTCTTTACATGG - Intronic
1027976731 7:85166838-85166860 TTTGACATTTTATATCTGAAGGG + Intronic
1028011816 7:85654824-85654846 TTTGACAATTAAAGTTTATATGG + Intergenic
1028024116 7:85815115-85815137 TTTATCATTTAAACTATAAACGG + Intergenic
1028040794 7:86051601-86051623 TTTTACATTTTATATTTAATCGG + Intergenic
1028566776 7:92242161-92242183 TGTGTCATTTAATCTTTCAAAGG - Intronic
1029023208 7:97387054-97387076 TTTGAGCTTTAATTTCTAAATGG + Intergenic
1029870193 7:103682680-103682702 TTTCACAATTTATCTGTAAATGG + Intronic
1029911063 7:104148724-104148746 TTTAAGGTTTAATTTTTAAAAGG + Intronic
1030474608 7:110015077-110015099 TTTGTCTTTTATTCTGTAAATGG + Intergenic
1030563470 7:111121115-111121137 TGAGAAATTTAATCGTTAAAAGG - Intronic
1031352316 7:120749552-120749574 TATGATATTTAATCATAAAAAGG + Exonic
1031446878 7:121865554-121865576 TTTTTTTTTTAATCTTTAAATGG + Intergenic
1031460845 7:122046904-122046926 TTAGACATTTCATTTTTAATTGG - Intronic
1032650697 7:133874931-133874953 GAGGACATGTAATCTTTAAAAGG + Intronic
1033122564 7:138678889-138678911 TTTTGCATTTAACCTTAAAAAGG + Intronic
1033400944 7:141024580-141024602 TGTGAGATTTATGCTTTAAAGGG + Intergenic
1034706082 7:153146194-153146216 TTTTATAAGTAATCTTTAAAGGG - Intergenic
1034845883 7:154444117-154444139 ATGCACATTTAATTTTTAAATGG - Intronic
1035014234 7:155750619-155750641 TATGACGTTTAATCCTTACAAGG - Intronic
1035439037 7:158880576-158880598 TTTGAAATTTAACATTGAAAAGG + Intronic
1035928107 8:3751242-3751264 TTTGGCATTTAATTCTAAAACGG - Intronic
1036154732 8:6330775-6330797 TTTGCCATTAAATATTTATAAGG + Intergenic
1036192611 8:6684578-6684600 TTTGTCTTTTATTCTTTAAAAGG + Intergenic
1036425827 8:8644492-8644514 TTTGATATGTAAATTTTAAAGGG + Intergenic
1037071635 8:14657393-14657415 TTTGACAGCTAATATTAAAATGG + Intronic
1037112240 8:15177493-15177515 TTATACATTTAATCTTACAATGG + Intronic
1038601291 8:28945867-28945889 TTTGACCTATATACTTTAAATGG - Intronic
1039645277 8:39275613-39275635 TTTGAAATTTAAACTTTTTATGG + Intronic
1040925723 8:52680459-52680481 TTTCAGATTTCATCTTGAAATGG - Intronic
1041073109 8:54144364-54144386 TTTGAAAATTAATATATAAAAGG + Intronic
1041497986 8:58508043-58508065 TTTGAATTCTACTCTTTAAAGGG - Intergenic
1041958418 8:63583152-63583174 TTTGAGATAGAATCTTTACAGGG + Intergenic
1042418357 8:68554108-68554130 TCTGAAATTTAACCTTTTAAAGG + Intronic
1042484848 8:69337912-69337934 ATTGACTTTTATTCTCTAAAAGG - Intergenic
1042746585 8:72114396-72114418 GTTAAGAATTAATCTTTAAATGG - Intronic
1043030427 8:75127682-75127704 TTTAATATTTAATCTTTACGTGG + Intergenic
1043395346 8:79830024-79830046 TTTGTCATTTACATTTTAAATGG - Intergenic
1043739546 8:83793231-83793253 TTTGACAGTTAATGCTTCAAGGG + Intergenic
1043817238 8:84816216-84816238 TTTGACATGTAACCTTAAAATGG - Intronic
1043846968 8:85175024-85175046 TTTTAAATTTCAGCTTTAAAAGG - Intergenic
1044001841 8:86892346-86892368 CTTGACAATTAATTTATAAATGG - Intronic
1044232138 8:89790914-89790936 TTTGAAATATCATTTTTAAAGGG - Exonic
1044622122 8:94200926-94200948 TTTTTCATTTCATCTTTAAGAGG - Intronic
1045094976 8:98787978-98788000 TGTGAGATTTATGCTTTAAAGGG - Intronic
1045592616 8:103614464-103614486 TTTAACTTTGAATCATTAAAAGG - Intronic
1045819258 8:106316590-106316612 TTCAACATTTAATCTTTACAGGG - Intronic
1046266079 8:111832038-111832060 TTTGACATGTAATCTCCACAGGG - Intergenic
1047480972 8:125282582-125282604 TTTGTCTTTTAATTTTCAAACGG + Intronic
1050241140 9:3636655-3636677 TTCGGCATTTTATCTTTAAAGGG + Intergenic
1050692031 9:8239019-8239041 TATGTCATTTAATACTTAAAGGG - Intergenic
1050700292 9:8330855-8330877 CTTGACATCTAATCTTTTTATGG - Intronic
1051550777 9:18326567-18326589 TTTGACATTTAATATATATCAGG + Intergenic
1052545812 9:29876755-29876777 TATCACATTTAATGTTTTAAAGG + Intergenic
1052605641 9:30695906-30695928 TTTGACATATAATGTCTAAGGGG + Intergenic
1052916994 9:33930962-33930984 TTTGACTTTTATTTATTAAAAGG + Intronic
1055217117 9:73878102-73878124 TTTGACATATTTTCTTTAACTGG + Intergenic
1055668881 9:78580435-78580457 GTTGACAGGTAATCTATAAAAGG - Intergenic
1055830333 9:80370728-80370750 TTTGACTTTTAGTCTTTATTTGG - Intergenic
1056251953 9:84757756-84757778 TTTGACTTTTCTTCTTTTAATGG + Intronic
1056309615 9:85326052-85326074 TGTGACATTTATGCTTTAAGGGG - Intergenic
1056485198 9:87049621-87049643 ATTGACTTGTAAACTTTAAAAGG + Intergenic
1058216587 9:102241323-102241345 TTTGACATCTTATTTTTATATGG + Intergenic
1058809112 9:108621955-108621977 TTTGACTTTTAATTGCTAAATGG - Intergenic
1059036834 9:110763112-110763134 TTTAACAGTAAAACTTTAAAAGG - Intronic
1059484679 9:114617510-114617532 TTTTCCATTTATTCTTTACATGG + Intronic
1060535406 9:124382607-124382629 TTTCACATTGATTATTTAAATGG - Intronic
1061525864 9:131161564-131161586 TTCAACATATAATTTTTAAAAGG - Intronic
1062337436 9:136078409-136078431 TTTTCCATTTAATCTTTAAATGG + Intronic
1203522851 Un_GL000213v1:59648-59670 TTTTAAATATAATCTTTAAAAGG - Intergenic
1186004896 X:5058628-5058650 TATGTCATTTAATCCTCAAAAGG - Intergenic
1186372556 X:8962127-8962149 TTTTACAGTTCTTCTTTAAAAGG + Intergenic
1187660369 X:21539918-21539940 TTTAACATTTAATTTTAAAAAGG - Intronic
1188052145 X:25501038-25501060 TTTGATATATTATCTTTTAAAGG - Intergenic
1188065606 X:25655953-25655975 TTTAAAAATTAATCTTAAAAAGG - Intergenic
1188328667 X:28840347-28840369 TTTAACACTAAAACTTTAAAAGG + Intronic
1188338080 X:28963179-28963201 TTTGACTTTTAATGTTGCAAAGG + Intronic
1188701801 X:33273609-33273631 TTTGACTTTTTATATTTGAAGGG + Intronic
1188964144 X:36530063-36530085 TTTGAAACTCAATCTTTTAAGGG - Intergenic
1189448288 X:41102104-41102126 TTTGACTTGTACACTTTAAATGG + Intronic
1189517255 X:41726300-41726322 TTTAACATTAAATATTTGAAAGG + Intronic
1189618122 X:42806278-42806300 TTTGACATATTATTTTTATATGG - Intergenic
1189663079 X:43324630-43324652 TTTGAGATTTATGCTTTAAGGGG + Intergenic
1189925937 X:45954883-45954905 TTTGACATTTCATCTTATAATGG + Intergenic
1190121521 X:47663654-47663676 TTTAACATTTAATGTTATAAAGG - Intergenic
1190934971 X:54991347-54991369 TTTATAATTTAATCTATAAAAGG - Intronic
1191644166 X:63462130-63462152 TTTGGCATCTAATTTTTAGATGG - Intergenic
1192037223 X:67576961-67576983 ATTGACATTTACAGTTTAAATGG - Intronic
1193054843 X:77138823-77138845 TTTTACATATAATGTTTAATTGG + Intergenic
1193211752 X:78814763-78814785 GATGACATTTAATCTATAGATGG - Intergenic
1193677966 X:84480632-84480654 TTTATTCTTTAATCTTTAAATGG + Intronic
1194251237 X:91577583-91577605 TTCGACATTCAACATTTAAAAGG + Intergenic
1194399650 X:93427664-93427686 TCTGGCATTTAATCTGTAAATGG - Intergenic
1194437708 X:93888958-93888980 TTTGTAATTTAATTTTGAAATGG + Intergenic
1194511524 X:94801879-94801901 TTTGAGATTAAATGTTAAAAAGG - Intergenic
1194656018 X:96574578-96574600 TTTGAGATACAATATTTAAAAGG + Intergenic
1196041252 X:111206599-111206621 TTTGTTGTTTAATCCTTAAAAGG - Intronic
1196074922 X:111565497-111565519 TTGGACATCAAAGCTTTAAAGGG + Intergenic
1196251566 X:113466328-113466350 TTTGACATTTTGTTTTTATATGG + Intergenic
1196777542 X:119353278-119353300 TTTGACATTTATTTCTAAAAAGG - Intergenic
1197264477 X:124353849-124353871 TTTGTCCTTTAAGTTTTAAAGGG + Intronic
1197613212 X:128661876-128661898 TTACACATTTAATCTCTTAATGG - Intergenic
1197870190 X:131057334-131057356 TTTGATATTTGATATTTCAATGG - Intergenic
1198632793 X:138660241-138660263 TTTCCAATTTAATCTGTAAAAGG + Intronic
1199366273 X:146987851-146987873 TGCTACATTTTATCTTTAAAAGG - Intergenic
1199441600 X:147875039-147875061 TTTGTATTTTAATATTTAAAAGG + Intergenic
1200309283 X:155061145-155061167 TTTAGCATGTAATCTATAAAAGG + Intergenic
1200570178 Y:4818815-4818837 TTCGACATTCAACATTTAAAAGG + Intergenic
1200596172 Y:5143508-5143530 TTTCACACTTACTCTGTAAAGGG - Intronic
1200829529 Y:7677788-7677810 TTTGGGATTTTATCTGTAAAAGG - Intergenic
1201291260 Y:12421831-12421853 TTGGACATTTAACCTTTAATTGG + Intergenic
1202012714 Y:20364035-20364057 TTTGACATTTTATCATTATTTGG - Intergenic
1202109247 Y:21404578-21404600 TTTGCGATTTTATCTGTAAAAGG - Intergenic